KIAA0173

Product ID	ORK00444
Accession No	D79995
Description	tubulin tyrosine ligase-like family member 4
Clone name	ha02346
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4831 bp) Predicted protein sequence (1203 aa)
HaloTag ORF Clone	FHC00444
Flexi ORF Clone	FXC00444
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0173 by Kazusa Mouse cDNA Project

Length: 4831 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1024 bp
Genome contig ID	gi89161199f_219210546
PolyA signal sequence (AGTAAA,-21)	+--------+--------+----*----+---- CCTCCTCTAGACTCAGTAAACAGTGACTATTCAAT
Flanking genome sequence (117836 - 117885)	----+--------+--------+--------+--------+----* AAATGTTGACTGAGTGAACTGTATTTACAGAGATCTCAAAGGACCCCAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	219283975	219328380	20	99.4	Perfect prediction

Length: 1203 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09639	100.0	tubulin--tyrosi...	synthetic construct
Q14679	99.9	Tubulin polyglu...	Homo sapiens
AAH21707	99.6	Tubulin tyrosin...	Homo sapiens
XP_516095	99.4	tubulin tyrosin...	Pan troglodytes
XP_001158991	99.0	tubulin tyrosin...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023215	8.3e-38	38.0	KIAA0998

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004344	655	950	PF03133	Tubulin-tyrosine ligase
ProfileScan	IPR004344	608	951	PS51221	Tubulin-tyrosine ligase

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GCTTGGTAGGTGGGTTTCAGG
Primer_r	AGAGGAGGGAGGTAGAATCAG
PCR product length	102 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles