Gene/Protein Characteristic Table for KIAA0157
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00435
Accession No D63877
Description family with sequence similarity 175, member B
Clone name ha03221
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (2957 bp)
Predicted protein sequence (419 aa)
Flexi ORF Clone FXC00435
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0157 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 2957 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1695 bp
Genome contig ID gi89161187f_126380375
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
GTTAAATGTGACAATAAAAAACTTATTTAATCATG
Flanking genome sequence
(134853 - 134902)
----+----*----+----*----+----*----+----*----+----*
GTACCATTGTTTTAATGTCTGTCTCAGCACCGGACAAGGCCTTGCCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 10 f 126480375 126515226 9 99.1 Perfect prediction
Features of the protein sequence
Description

Length: 419 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001083977 6.4e-145 98.8 hypothetical pr...
Macaca mulatta
BAG59274 3.8e-144 99.3 unnamed protein...
Homo sapiens
XP_535051 8.8e-139 95.2 hypothetical pr...
Canis lupus fam...
EDL17753 1.7e-135 93.1 RIKEN cDNA C430...
Mus musculus
XP_587356 3.7e-135 93.3 hypothetical pr...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 10
Experimental conditions
Panel name Genebridge 4
Primer_f ACCACTAAGACATTCAGGAGC
Primer_r AAGACAGACCCCCATAGAGTG
PCR product length 314 bp
PCR conditions 95 °C15 sec62 °C120 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp