KIAA0161

Product ID	ORK00437
Accession No	D79983
Description	ring finger protein 144A
Clone name	ha02800
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5559 bp) Predicted protein sequence (326 aa)
HaloTag ORF Clone	FHC00437
Flexi ORF Clone	FXC00437
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0161 by Kazusa Mouse cDNA Project

Length: 5559 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	4332 bp
Genome contig ID	gi89161199f_6875126
PolyA signal sequence (AATACA,-18)	+--------+--------+----*----+---- GTTTGATTTGTAATTTCAATACATATTTTAAATGT
Flanking genome sequence (226551 - 226600)	----+--------+--------+--------+--------+----* ATTGTGTCTTACGTAGTTTGTCCCCCCCTTTAGCAGGGATTCCTTTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	6975068	7101675	9	99.2	Perfect prediction

Length: 326 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_515284	5e-149	99.4	ring finger pro...	Pan troglodytes
AAH50373	1.1e-134	100.0	Ring finger pro...	Homo sapiens
P50876	2.4e-134	99.7	Probable E3 ubi...	Homo sapiens
XP_851312	4.5e-131	95.7	similar to Ubiq...	Canis lupus fam...
Q925F3	6e-131	96.9	Probable E3 ubi...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014608	4.1e-12	26.9	KIAA0708
AB037807	0.00038	28.1	KIAA1386

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	54	100	PF00097	Zinc finger
HMMPfam	IPR002867	125	190	PF01485	Zinc finger
HMMSmart	IPR002867	125	190	SM00647	Zinc finger
HMMSmart	IPR002867	202	266	SM00647	Zinc finger
ProfileScan	IPR001841	54	100	PS50089	Zinc finger
ScanRegExp	IPR001841	240	249	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	289	AGFGLLLLVASPFLLLATPFVLC	311	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	CCATGCCTGCCCTTTCTTTCC
Primer_r	TTTGTTTCACCACCACTTGTC
PCR product length	129 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles