KIAA0164

Product ID	ORK00033
Accession No	D79986
Description	BCL2-associated transcription factor 1, transcript variant 1
Clone name	ha02373
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5538 bp) Predicted protein sequence (929 aa)
HaloTag ORF Clone	FHC00033
Flexi ORF Clone	FXC00033
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0164 by Kazusa Mouse cDNA Project

Length: 5538 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2522 bp
Genome contig ID	gi89161210r_136521419
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTGTCATACGCCAATAAAATGTCACAAGTAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGCTGTTGTTTGTTTACCTGTGTCTATTTCACACATCTTATTTCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	136621419	136652682	13	100.0	Perfect prediction

Length: 929 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NYF8	100.0	Bcl-2-associate...	Homo sapiens
XP_001170895	99.9	BCL2-associated...	Pan troglodytes
XP_518759	99.9	BCL2-associated...	Pan troglodytes
AAI44282	99.8	BCLAF1 protein ...	Homo sapiens
XP_849956	98.4	similar to Bcl-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	1.1e-05	24.5	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	AATAACTCACTGATACCTGCG
Primer_r	ACACACCTAAAGAGTCATGGC
PCR product length	129 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles