KIAA0168

Product ID	ORK00440
Accession No	D79990
Description	Ras association (RalGDS/AF-6) domain family member 2, transcript variant 1
Clone name	ha02316
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5426 bp) Predicted protein sequence (331 aa)
HaloTag ORF Clone	FHC00440
Flexi ORF Clone	FXC00440
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0168 by Kazusa Mouse cDNA Project

Length: 5426 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4249 bp
Genome contig ID	gi51511747r_4608670
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTAGATCTTACTGAAATAAAGCACTTTTCAAAGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGCCCCGTGGATGGGTCTGTGTGTGACTGCTGGCTGCGGGAGCTCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	4708670	4752291	12	100.0	Perfect prediction

Length: 331 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P50749	1.5e-127	100.0	Ras association...	Homo sapiens
XP_001164287	1.8e-127	99.7	Ras association...	Pan troglodytes
BAD96370	1.4e-126	99.4	Ras association...	Homo sapiens
XP_542904	6.5e-123	95.7	similar to Ras ...	Canis lupus fam...
XP_001925229	1.8e-122	96.0	similar to Ras ...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000159	181	269	PF00788	Ras-association
HMMSmart	IPR000159	179	270	SM00314	Ras-association
ProfileScan	IPR000159	181	269	PS50200	Ras-association
ProfileScan	IPR011524	277	324	PS50951	SARAH

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	ATAGCAGCACACATTTTCACG
Primer_r	TACACACCAGAAACATCAGCC
PCR product length	303 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles