KIAA0171

Product ID	ORK00442
Accession No	D79993
Description	clathrin interactor 1, transcript variant 2
Clone name	ha02502
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3336 bp) Predicted protein sequence (655 aa)
HaloTag ORF Clone	FHC00442
Flexi ORF Clone	FXC00442
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0171 by Kazusa Mouse cDNA Project

Length: 3336 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1357 bp
Genome contig ID	gi51511721r_157045875
PolyA signal sequence (ATTAAA,-9)	+--------+--------+----*----+---- CTGTTATACATAACATTAAAATGTTCATTAAAATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGTTGAACTGCTTTTTCTTTCGTTCTGTTAGACATTTGAGACCATTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	157145875	157218657	12	100.0	Perfect prediction

Length: 655 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAI25020	2.7e-198	94.4	clathrin intera...	Mus musculus
BAE25429	4.3e-198	94.2	unnamed protein...	Mus musculus
BAE28195	8.8e-197	93.6	unnamed protein...	Mus musculus
XP_001138881	3.8e-196	94.5	epsin 4 isoform...	Pan troglodytes
XP_001068435	4.7e-195	94.4	similar to Epsi...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028988	5.6e-15	27.2	KIAA1065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001026	51	175	PF01417	Epsin
HMMSmart	IPR013809	52	179	SM00273	Epsin-like
ProfileScan	IPR013809	46	179	PS50942	Epsin-like

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TTTTTCAGGACTGCTCTATGG
Primer_r	TACAGGGATAAACACGGAAGG
PCR product length	122 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles