Gene/Protein Characteristic Table for KIAA1065
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK02016
Accession No AB028988
Description epsin 2, transcript variant 2
Clone name hj05094
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (4799 bp)
Predicted protein sequence (665 aa)
Flexi ORF Clone FXC02016
Source Human adult brain
Rouge ID mKIAA1065 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 4799 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 2460 bp
Genome contig ID gi51511734f_18855279
PolyA signal sequence
(TATAAA,-29)
+----*----+----*----+----*----+----
TTACTGTATAAATATAATTTATCATTTGTACCATG
Flanking genome sequence
(325343 - 325392)
----+----*----+----*----+----*----+----*----+----*
ATGCGGTTTCTGGCTGTGTCCTTCTCCCACCCCATCTTCATCAGTCCTGT

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 17 f 19081318 19180620 11 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 665 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW50875 6.8e-203 100.0 epsin 2, isofor...
Homo sapiens
O95208 1.2e-202 99.8 Epsin-2; EPS-15...
Homo sapiens
XP_001154310 2.4e-202 99.7 epsin 2 isoform...
Pan troglodytes
XP_001154203 9.5e-202 99.5 epsin 2 isoform...
Pan troglodytes
AAC78609 1.9e-201 99.5 epsin 2b [Homo ...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D79993 1.5e-11 27.6 KIAA0171
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001026 41 164 PF01417 Epsin
IPR003903 298 315 PF02809 Ubiquitin interacting motif
HMMSmart IPR013809 42 168 SM00273 Epsin-like
IPR003903 299 318 SM00726 Ubiquitin interacting motif
IPR003903 324 343 SM00726 Ubiquitin interacting motif
ProfileScan IPR013809 36 168 PS50942 Epsin-like
IPR003903 299 318 PS50330 Ubiquitin interacting motif
IPR003903 324 343 PS50330 Ubiquitin interacting motif
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGTTCCTGACCAGCCACCTTC
Primer_r ATCCTGCCTCCCATCCCATTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 17
Experimental conditions
Panel name GeneBridge 4
Primer_f AGTTCCTGACCAGCCACCTTC
Primer_r ATCCTGCCTCCCATCCCATTG
PCR product length 140 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp