KIAA0179

Product ID	ORK01056
Accession No	D80001
Description	ribosomal RNA processing 1B
Clone name	ha02738
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4994 bp) Predicted protein sequence (762 aa)
HaloTag ORF Clone	FHC01056
Flexi ORF Clone	FXC01056
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0179 by Kazusa Mouse cDNA Project

Length: 4994 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2705 bp
Genome contig ID	gi51511750f_43803908
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- CAAGTCCAATTAAAAAAAAAAAGTCTTTGCCCTCC
Flanking genome sequence (136480 - 136529)	----+--------+--------+--------+--------+----* AATTTGTGTTTGATGTTGACTTTCAGTATGGGTAAAAATAGGCCTCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	21	f	43903908	43940386	16	99.2	Perfect prediction

Length: 762 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG11148	0	100.0	RRP1-like prote...	synthetic construct
Q14684	0	97.6	Ribosomal RNA p...	Homo sapiens
XP_001144331	0	96.8	hypothetical pr...	Pan troglodytes
XP_001144086	1.8e-208	92.5	hypothetical pr...	Pan troglodytes
XP_001104749	2.8e-195	85.2	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010301	30	224	PF05997	Nucleolar

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GTTGCAGGTGTTGGGAGGAAG
Primer_r	ATTGGACTTGGCTTTGACGAG
PCR product length	158 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles