|
Order Kazusa clone(s) from : |
| Product ID | ORK05365 |
|---|---|
| Accession No | D80004 |
| Description | Gse1 coiled-coil protein |
| Clone name | ha02329s1 |
| Vector information | |
| cDNA sequence | DNA sequence (7133 bp) Predicted protein sequence (1157 aa) |
| Source | Myeloblast cell line (KG-1) |
| Rouge ID |
mKIAA0182
by Kazusa Mouse cDNA Project
|
| Note | We replaced ha02329, former representative clones for KIAA0182 with ha02329s1. (2008/8/27) |
Length: 7133 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 3658 bp |
|---|---|
| Genome contig ID | gi51511732f_84104459 |
| PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (162854 - 162903) |
----+----*----+----*----+----*----+----*----+----* |
Length: 1157 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Chromosome No. 16
Experimental conditions| Panel name | Genebridge 4 |
|---|---|
| Primer_f | CAAGATGGAGATGGTCAGCAC |
| Primer_r | TAGCATGGTCTTCCTCAGGTC |
| PCR product length | 199 bp |
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |