KIAA0187

Product ID	ORK01058
Accession No	D80009
Description	BMS1 ribosome biogenesis factor
Clone name	ha02920
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4181 bp) Predicted protein sequence (1285 aa)
HaloTag ORF Clone	FHC01058
Flexi ORF Clone	FXC01058
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0187 by Kazusa Mouse cDNA Project

Length: 4181 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	305 bp
Genome contig ID	gi89161187f_42499822
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GGCCTACAGAAATATCATTAAAATATTTTTTTGTT
Flanking genome sequence (147035 - 147084)	----+--------+--------+--------+--------+----* ACTTTTGGCTTAGTAGTTTTCATTAGGGATGAATGCCTGACAATTCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	42599822	42646855	22	99.8	Perfect prediction

Length: 1285 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14692	100.0	Ribosome biogen...	Homo sapiens
AAH43345	99.9	BMS1 homolog, r...	Homo sapiens
XP_521453	99.5	BMS1-like, ribo...	Pan troglodytes
CAH93478	98.8	hypothetical pr...	Pongo abelii
XP_001928816	91.4	BMS1 homolog, r...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037822	2.3e-10	22.8	KIAA1401

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012948	234	320	PF08142	AARP2CN
HMMPfam	IPR007034	814	1107	PF04950	Protein of unknown function DUF663
HMMSmart	IPR012948	234	320	SM00785	AARP2CN

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GCTAAGGACCAGAAGAAACAC
Primer_r	TCCGGGCATCTTCTTCGTCTC
PCR product length	109 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles