KIAA1401

Product ID	ORK07232
Accession No	AB037822
Description	TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Clone name	hk09639
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4107 bp) Predicted protein sequence (853 aa)
Source	Human adult brain
Rouge ID	mKIAA1401 by Kazusa Mouse cDNA Project

Length: 4107 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	612 bp
Genome contig ID	gi51511734r_2073627
PolyA signal sequence (TATAAA,-17)	+--------+--------+----*----+---- GAGTCTAGTTGGTTTACCTATAAAGTTCAGATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATACGTGTCCAGTTTGAATTTTCTTATCACTGTGTACACACGCTTCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	2173627	2187551	15	99.8	Perfect prediction

Length: 853 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG72839	100.0	TSR1, 20S rRNA ...	synthetic construct
Q2NL82	99.9	Pre-rRNA-proces...	Homo sapiens
Q5R434	98.0	Pre-rRNA-proces...	Pongo abelii
XP_001086730	97.1	similar to Temp...	Macaca mulatta
AAH19090	99.7	TSR1 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D80009	1.8e-13	22.8	KIAA0187

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012948	277	358	PF08142	AARP2CN
HMMPfam	IPR007034	535	822	PF04950	Protein of unknown function DUF663
HMMSmart	IPR012948	277	358	SM00785	AARP2CN

Primer_f	CCACTGAGCACAATACAAATG
Primer_r	CCAACTAGACTCCCCTTTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCACTGAGCACAATACAAATG
Primer_r	CCAACTAGACTCCCCTTTCAC
PCR product length	186 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles