KIAA0188

Product ID	ORK01962
Accession No	D80010
Description	lipin 1, transcript variant 1
Clone name	ha02734
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5307 bp) Predicted protein sequence (899 aa)
HaloTag ORF Clone	FHC01962
Flexi ORF Clone	FXC01962
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0188 by Kazusa Mouse cDNA Project

Length: 5307 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	2606 bp
Genome contig ID	gi89161199f_11723109
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGAAAATATTGCAATAAATGAGACCGATGAAAGAC
Flanking genome sequence (161868 - 161917)	----+--------+--------+--------+--------+----* TTCTCTGAAAATCAGGTGTGTGAATTTTAAATAGTTTTTGGTAAGTTACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	11804230	11884975	20	99.5	Perfect prediction

Length: 899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX00918	100.0	lipin 1, isofor...	Homo sapiens
BAH13844	99.8	unnamed protein...	Homo sapiens
Q14693	100.0	Lipin-1.	Homo sapiens
AAH30537	99.9	Lipin 1 [Homo s...	Homo sapiens
ABM85602	99.8	lipin 1 [synthe...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87436	5.3e-88	51.6	KIAA0249

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007651	10	123	PF04571	Lipin
HMMPfam	IPR013209	683	839	PF08235	LNS2
HMMSmart	IPR013209	683	839	SM00775	LNS2

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GCAAGGCTGGCATATTAACAC
Primer_r	AGGGCAACTTTGAAATGTGTG
PCR product length	173 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles