Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01059 |
---|---|
Accession No | D83781 |
Description | nucleoporin 160kDa |
Clone name | ha03030 |
Vector information | |
cDNA sequence | DNA sequence (4814 bp) Predicted protein sequence (1314 aa) |
HaloTag ORF Clone |
FHC01059
|
Flexi ORF Clone | FXC01059 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0197
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 868 bp |
---|---|
Genome contig ID | gi51511727r_47656365 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | r | 47756365 | 47826441 | 34 | 99.7 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ScanRegExp | IPR000560 | 1047 | 1061 | PS00616 | Histidine acid phosphatase |
Panel name | Stanford G3 |
---|---|
Primer_f | GTGCTTGCTGGTGGTGCTAAC |
Primer_r | TACAACAAGCCAACAACCCTC |
PCR product length | 185 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |