KIAA0201

Product ID	ORK00455
Accession No	D86956
Description	heat shock 105kDa/110kDa protein 1, transcript variant 1
Clone name	ha03256
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3614 bp) Predicted protein sequence (949 aa)
HaloTag ORF Clone	FHC00455
Flexi ORF Clone	FXC00455
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0201 by Kazusa Mouse cDNA Project

Length: 3614 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	690 bp
Genome contig ID	gi51511729r_30508765
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CTTTAAAATAAAGTTCATCTTATGGTGTCATTTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGTTGATTTTGTCACTAATTTAAAAAATGAGATGAGGGAGAATATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	30608765	30634066	18	100.0	Perfect prediction

Length: 949 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001142849	99.7	heat shock 105k...	Pan troglodytes
AAC18044	100.0	antigen NY-CO-2...	Homo sapiens
Q92598	100.0	Heat shock prot...	Homo sapiens
Q5R606	99.9	Heat shock prot...	Pongo abelii
XP_001493567	96.4	similar to heat...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR013126	202	255	PD000089	Heat shock protein 70
FPrintScan	IPR001023	93	106	PR00301	Heat shock protein Hsp70
	IPR001023	121	133	PR00301	Heat shock protein Hsp70
	IPR001023	143	151	PR00301	Heat shock protein Hsp70
	IPR001023	231	251	PR00301	Heat shock protein Hsp70
	IPR001023	426	442	PR00301	Heat shock protein Hsp70
	IPR001023	457	477	PR00301	Heat shock protein Hsp70
HMMPfam	IPR013126	94	799	PF00012	Heat shock protein 70
ScanRegExp	IPR013126	429	443	PS01036	Heat shock protein 70

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ATGGACTTGGACTAGATAACC
Primer_r	AGTTACCAAGGCAATTTTCCC
PCR product length	210 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles