KIAA0204

Product ID	ORK06896
Accession No	D86959
Description	STE20-like kinase, transcript variant 2
Clone name	ha02801
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5988 bp) Predicted protein sequence (1164 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0204 by Kazusa Mouse cDNA Project

Length: 5988 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2018 bp
Genome contig ID	gi89161187f_105616983
PolyA signal sequence (GATAAA,-23)	+--------+--------+----*----+---- TTATATTGTTATGATAAAAATGACAGTATAATGTT
Flanking genome sequence (160351 - 160400)	----+--------+--------+--------+--------+----* GCCCAGTGTATTTAATGATTTATTTGAAGAGGGATTGGGAAGGAACGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	105716983	105777332	18	99.5	Perfect prediction

Length: 1164 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA19655	99.7	hSLK [Homo sapi...	Homo sapiens
XP_001137318	99.2	serine/threonin...	Pan troglodytes
XP_001114185	96.8	similar to seri...	Macaca mulatta
XP_001497765	87.8	STE20-like kina...	Equus caballus
XP_001929461	88.8	STE20-like kina...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011123	3e-16	26.6	KIAA0551
AB014587	7.9e-15	26.6	KIAA0687
AB020688	6e-14	24.7	KIAA0881
AB037782	4.2e-13	25.4	KIAA1361
AB032968	1.7e-11	33.6	KIAA1142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	47	292	PD000001	Protein kinase
HMMPfam	IPR000719	46	304	PF00069	Protein kinase
HMMSmart	IPR001245	46	304	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	46	304	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	46	304	PS50011	Protein kinase
ProfileScan	IPR001943	887	922	PS50151	UvrB/UvrC protein
ScanRegExp	IPR000719	52	75	PS00107	Protein kinase
ScanRegExp	IPR008271	163	175	PS00108	Serine/threonine protein kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GAAAACTTTGGATGCTGAACC
Primer_r	CTACCTACGAAGTTGTCCAAG
PCR product length	120 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles