KIAA0244

Product ID	ORK00040
Accession No	D87685
Description	PHD finger protein 3, transcript variant 1
Clone name	ha04644s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) without using any linker or adapter and a RT-PCR product (1-1944) was subcloned upstream of the cDNA (1945-6936). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA GGCCGCGGGA ATTCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (6936 bp) Predicted protein sequence (2044 aa)
Flexi ORF Clone	FXC00040
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0244 by Kazusa Mouse cDNA Project
Note	We replaced ha04644, former representative clones for KIAA0244 with ha04644s1. (2002/5/10)

Length: 6936 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	801 bp
Genome contig ID	gi89161210f_64314401
PolyA signal sequence (AGTAAA,-28)	+--------+--------+----*----+---- ATTCAGTAGTAAAAGAATTTCTTCTTTAAAGCTTT
Flanking genome sequence (167965 - 168014)	----+--------+--------+--------+--------+----* AATTACCTTCAGACATTGATTTTTTGTTACTCAGCCAAGAACATATAGAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	64414401	64482364	15	99.7	Perfect prediction

Length: 2044 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92576	100.0	PHD finger prot...	Homo sapiens
CAI56715	99.9	hypothetical pr...	Homo sapiens
XP_538985	87.8	similar to PHD ...	Canis lupus fam...
XP_001503413	86.9	similar to PHD ...	Equus caballus
XP_867023	87.3	similar to PHD ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002331	1.4e-12	37.8	KIAA0333

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	724	777	PF00628	Zinc finger
	IPR003618	932	1045	PF07500	Transcription elongation factor S-II
	IPR012921	1214	1320	PF07744	Spen paralogue and orthologue C-terminal
HMMSmart	IPR001965	724	775	SM00249	Zinc finger
HMMSmart	IPR003618	934	1034	SM00510	Transcription elongation factor S-II
ProfileScan	IPR001965	722	777	PS50016	Zinc finger
ScanRegExp	IPR001965	725	774	PS01359	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CATCCCTTCTTCATACCAACG
Primer_r	TTGGGCTTCTGATTCTTGGTC
PCR product length	351 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles