Order Kazusa clone(s) from : ![]() |
Product ID | ORK01068 |
---|---|
Accession No | AB002331 |
Description | death inducer-obliterator 1, transcript variant 3 |
Clone name | pf04993 |
Vector information | |
cDNA sequence | DNA sequence (7013 bp) Predicted protein sequence (1223 aa) |
Flexi ORF Clone | FXC01068 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA0333
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00988, former representative clones for KIAA0333 with pf04993. (2001/10/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3155 bp |
---|---|
Genome contig ID | gi51511747r_60889014 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 20 | r | 60989014 | 61039681 | 16 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 304 | 356 | PF00628 | Zinc finger |
IPR003618 | 704 | 818 | PF07500 | Transcription elongation factor S-II | |
IPR012921 | 1091 | 1197 | PF07744 | Spen paralogue and orthologue C-terminal | |
HMMSmart | IPR001965 | 304 | 354 | SM00249 | Zinc finger |
IPR003618 | 706 | 807 | SM00510 | Transcription elongation factor S-II | |
ProfileScan | IPR001965 | 302 | 356 | PS50016 | Zinc finger |
ScanRegExp | IPR001965 | 305 | 353 | PS01359 | Zinc finger |
![]() |
---|
Primer_f | TCCATGCAAAGCTACTGTTAC |
---|---|
Primer_r | CTGCTCGAATGGAAAGGGCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCATGCAAAGCTACTGTTAC |
Primer_r | CTGCTCGAATGGAAAGGGCTC |
PCR product length | 202 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |