KIAA0333

Product ID	ORK01068
Accession No	AB002331
Description	death inducer-obliterator 1, transcript variant 3
Clone name	pf04993
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7013 bp) Predicted protein sequence (1223 aa)
HaloTag ORF Clone	FHC01068
Flexi ORF Clone	FXC01068
Source	Human brain (hippocampus)
Rouge ID	mKIAA0333 by Kazusa Mouse cDNA Project
Note	We replaced hg00988, former representative clones for KIAA0333 with pf04993. (2001/10/06)

Length: 7013 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	3155 bp
Genome contig ID	gi51511747r_60889014
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTTCTCCTCCTAAATCAATAAACATCTTTCATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACTGGTCCTTGTTTGTTTGAATTGGAACCATTTGGTGGCTCCTGGTCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	60989014	61039681	16	99.8	Perfect prediction

Length: 1223 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAI95770	100.0	death inducer-o...	Homo sapiens
AAS49898	99.8	death inducer-o...	Homo sapiens
Q9BTC0	100.0	Death-inducer o...	Homo sapiens
NP_149072	100.0	death inducer-o...	Homo sapiens
AAS49899	99.8	death inducer-o...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87685	1.3e-14	37.4	KIAA0244

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001965	304	356	PF00628	Zinc finger
	IPR003618	704	818	PF07500	Transcription elongation factor S-II
	IPR012921	1091	1197	PF07744	Spen paralogue and orthologue C-terminal
HMMSmart	IPR001965	304	354	SM00249	Zinc finger
HMMSmart	IPR003618	706	807	SM00510	Transcription elongation factor S-II
ProfileScan	IPR001965	302	356	PS50016	Zinc finger
ScanRegExp	IPR001965	305	353	PS01359	Zinc finger

Primer_f	TCCATGCAAAGCTACTGTTAC
Primer_r	CTGCTCGAATGGAAAGGGCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCATGCAAAGCTACTGTTAC
Primer_r	CTGCTCGAATGGAAAGGGCTC
PCR product length	202 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles