KIAA0256

Product ID	ORK01062
Accession No	D87445
Description	SECIS binding protein 2-like, transcript variant 2
Clone name	eg00512
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6779 bp) Predicted protein sequence (1065 aa)
HaloTag ORF Clone	FHC01062
Flexi ORF Clone	FXC01062
Source
Rouge ID	mKIAA0256 by Kazusa Mouse cDNA Project
Note	We replaced ha04798, former representative clones for KIAA0256 with eg00512. (2001/10/06)

Length: 6779 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3474 bp
Genome contig ID	gi51511731r_46968259
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAAAACTAGCAAAATTAGTGTGAGTTATAACATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGGGATTTTCATCTTTTGCTGTATGAAGGATAATTGTTATATCACATTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	47068259	47125922	17	99.4	Perfect prediction

Length: 1065 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001113528	0	95.3	hypothetical pr...	Macaca mulatta
CAM22356	2e-207	83.8	novel protein [...	Mus musculus
AAI67330	6.2e-166	68.2	Unknown (protei...	Xenopus (Silura...
CAH91943	2.8e-161	94.0	hypothetical pr...	Pongo abelii
EDL28147	1.6e-153	78.4	mCG6131 [Mus mu...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004038	666	768	PF01248	Ribosomal protein L7Ae/L30e/S12e/Gadd45

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTCATCCCTTCCAACCTTTAC
Primer_r	GTACAGAAGAATCCCCACTAG
PCR product length	338 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles