Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00483 |
---|---|
Accession No | D87453 |
Description | mitochondrial ribosomal protein S27, transcript variant 2 |
Clone name | ha07040 |
Vector information | |
cDNA sequence | DNA sequence (2635 bp) Predicted protein sequence (415 aa) |
HaloTag ORF Clone |
FHC00483
|
Flexi ORF Clone | FXC00483 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0264
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1385 bp |
---|---|
Genome contig ID | gi51511721r_71451107 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 71551107 | 71651809 | 11 | 99.3 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Panel name | Genebridge 4 |
---|---|
Primer_f | GAAAATGAGAGATGGGTTGGG |
Primer_r | CTTAAGGGCAACACTACATAG |
PCR product length | 147 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |