Gene/Protein Characteristic Table for KIAA0266
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00042
Accession No D87455
Description UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast)
Clone name ha02755
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (5585 bp)
Predicted protein sequence (766 aa)
Flexi ORF Clone FXC00042
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0266 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5585 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Integrity of 3' end
Length of 3'UTR 2551 bp
Genome contig ID gi51511729f_51396828
PolyA signal sequence
(ATTAAA,-14)		 
+----*----+----*----+----*----+----
ATTCCCAAGCTCCATATGCCAATTAAAGAAGAAAC
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 13 f 51496828 51515697 4 98.8 Terminal No-hit
Features of the protein sequence
Description

Length: 766 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5TAP6 0 100.0 U3 small nucleo...
 Homo sapiens
AAI22537 0 99.9 UTP14, U3 small...
 Homo sapiens
AAH89407 0 99.9 UTP14C protein ...
 Homo sapiens
XP_509792 0 99.0 UTP14, U3 small...
 Pan troglodytes
XP_001106440 0 93.0 similar to UTP1...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006709 29 735 PF04615 Small-subunit processome
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 13
Experimental conditions
Panel name Genebridge 4
Primer_f CAGCAGTGGAGATTTGTATTC
Primer_r GAGCTTGGGAATATTAGTAGG
PCR product length 255 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp