Order Kazusa clone(s) from : ![]() |
Product ID | ORK00042 |
---|---|
Accession No | D87455 |
Description | UTP14, U3 small nucleolar ribonucleoprotein, homolog C (yeast) |
Clone name | ha02755 |
Vector information | |
cDNA sequence | DNA sequence (5585 bp) Predicted protein sequence (766 aa) |
HaloTag ORF Clone |
FHC00042
![]() |
Flexi ORF Clone | FXC00042 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0266
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2551 bp |
---|---|
Genome contig ID | gi51511729f_51396828 |
PolyA signal sequence (ATTAAA,-14) |
+----*----+----*----+----*----+---- |
Flanking genome sequence | None |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 13 | f | 51496828 | 51515697 | 4 | 98.8 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | CAGCAGTGGAGATTTGTATTC |
Primer_r | GAGCTTGGGAATATTAGTAGG |
PCR product length | 255 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |