Order Kazusa clone(s) from : ![]() |
Product ID | ORK01593 |
---|---|
Accession No | AB002305 |
Description | aryl-hydrocarbon receptor nuclear translocator 2 |
Clone name | hg00066 |
Vector information | |
cDNA sequence | DNA sequence (6415 bp) Predicted protein sequence (716 aa) |
Flexi ORF Clone | FXC01593 |
Source | Human adult brain |
Rouge ID |
mKIAA0307
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001067 | 77 | 92 | PR00785 | Nuclear translocator |
IPR001067 | 97 | 117 | PR00785 | Nuclear translocator | |
IPR001067 | 127 | 150 | PR00785 | Nuclear translocator | |
IPR001067 | 152 | 171 | PR00785 | Nuclear translocator | |
IPR001067 | 184 | 202 | PR00785 | Nuclear translocator | |
IPR001067 | 230 | 243 | PR00785 | Nuclear translocator | |
IPR001067 | 276 | 295 | PR00785 | Nuclear translocator | |
IPR001067 | 308 | 324 | PR00785 | Nuclear translocator | |
IPR001067 | 335 | 352 | PR00785 | Nuclear translocator | |
HMMPfam | IPR001092 | 63 | 116 | PF00010 | Basic helix-loop-helix dimerisation region bHLH |
IPR013767 | 136 | 243 | PF00989 | PAS fold | |
IPR013655 | 346 | 440 | PF08447 | PAS fold-3 | |
HMMSmart | IPR001092 | 68 | 121 | SM00353 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 136 | 203 | SM00091 | PAS | |
IPR000014 | 324 | 390 | SM00091 | PAS | |
IPR001610 | 397 | 440 | SM00086 | PAC motif | |
HMMTigr | IPR000014 | 320 | 447 | TIGR00229 | PAS |
ProfileScan | IPR001092 | 63 | 116 | PS50888 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 133 | 208 | PS50112 | PAS | |
IPR000014 | 341 | 392 | PS50112 | PAS |
![]() |
---|
Primer_f | GTTAGATGAAGCAAGCCGTCC |
---|---|
Primer_r | CATTTCCAAGCGTAGGTGTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTTAGATGAAGCAAGCCGTCC |
Primer_r | CATTTCCAAGCGTAGGTGTCC |
PCR product length | 150 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |