Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00509 |
---|---|
Accession No | AB002332 |
Description | clock circadian regulator, transcript variant 2 |
Clone name | hg01015 |
Vector information | |
cDNA sequence | DNA sequence (5715 bp) Predicted protein sequence (848 aa) |
HaloTag ORF Clone |
FHC00509
|
Flexi ORF Clone | FXC00509 |
Source | Human adult brain |
Rouge ID |
mKIAA0334
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001067 | 51 | 66 | PR00785 | Nuclear translocator |
IPR001067 | 102 | 125 | PR00785 | Nuclear translocator | |
IPR001067 | 277 | 294 | PR00785 | Nuclear translocator | |
HMMPfam | IPR001092 | 37 | 87 | PF00010 | Basic helix-loop-helix dimerisation region bHLH |
IPR013767 | 111 | 178 | PF00989 | PAS fold | |
IPR013655 | 288 | 381 | PF08447 | PAS fold-3 | |
HMMSmart | IPR001092 | 42 | 92 | SM00353 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 111 | 177 | SM00091 | PAS | |
IPR000014 | 266 | 332 | SM00091 | PAS | |
IPR001610 | 338 | 381 | SM00086 | PAC motif | |
ProfileScan | IPR001092 | 35 | 87 | PS50888 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 109 | 179 | PS50112 | PAS | |
IPR000014 | 287 | 334 | PS50112 | PAS |
RT-PCR |
---|
Primer_f | GGGCGGGATAGCTTTGCAACC |
---|---|
Primer_r | CGTAGTAGTGGAAGAGGTAGT |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGCGGGATAGCTTTGCAACC |
Primer_r | CGTAGTAGTGGAAGAGGTAGT |
PCR product length | 96 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |