Order Kazusa clone(s) from : ![]() |
Product ID | ORK00509 |
---|---|
Accession No | AB002332 |
Description | clock circadian regulator, transcript variant 2 |
Clone name | hg01015 |
Vector information | |
cDNA sequence | DNA sequence (5715 bp) Predicted protein sequence (848 aa) |
HaloTag ORF Clone |
FHC00509
![]() |
Flexi ORF Clone | FXC00509 |
Source | Human adult brain |
Rouge ID |
mKIAA0334
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001067 | 51 | 66 | PR00785 | Nuclear translocator |
IPR001067 | 102 | 125 | PR00785 | Nuclear translocator | |
IPR001067 | 277 | 294 | PR00785 | Nuclear translocator | |
HMMPfam | IPR001092 | 37 | 87 | PF00010 | Basic helix-loop-helix dimerisation region bHLH |
IPR013767 | 111 | 178 | PF00989 | PAS fold | |
IPR013655 | 288 | 381 | PF08447 | PAS fold-3 | |
HMMSmart | IPR001092 | 42 | 92 | SM00353 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 111 | 177 | SM00091 | PAS | |
IPR000014 | 266 | 332 | SM00091 | PAS | |
IPR001610 | 338 | 381 | SM00086 | PAC motif | |
ProfileScan | IPR001092 | 35 | 87 | PS50888 | Basic helix-loop-helix dimerisation region bHLH |
IPR000014 | 109 | 179 | PS50112 | PAS | |
IPR000014 | 287 | 334 | PS50112 | PAS |
![]() |
---|
Primer_f | GGGCGGGATAGCTTTGCAACC |
---|---|
Primer_r | CGTAGTAGTGGAAGAGGTAGT |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GGGCGGGATAGCTTTGCAACC |
Primer_r | CGTAGTAGTGGAAGAGGTAGT |
PCR product length | 96 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |