KIAA0327

Product ID	ORK05592
Accession No	AB002325
Description	protocadherin gamma subfamily A, 8
Clone name	hg00605
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6486 bp) Predicted protein sequence (898 aa)
Source	Human adult brain
Rouge ID	mKIAA0327 by Kazusa Mouse cDNA Project

Length: 6486 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1364 bp
Genome contig ID	gi51511721f_140649908
PolyA signal sequence (None)	+--------+--------+----*----+---- CGTCTCAAAAAAAAAAAACTAGTTCTAGATCGCGA
Flanking genome sequence	None

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	140749908	140793610	4	98.3	Terminal No-hit

Length: 898 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAD43775	100.0	protocadherin g...	Homo sapiens
Q9Y5G5	100.0	Protocadherin g...	Homo sapiens
Q5DRB2	97.9	Protocadherin g...	Pan troglodytes
XP_001092936	95.6	similar to prot...	Macaca mulatta
XP_001502169	82.8	similar to prot...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011160	1e-211	71.2	KIAA0588
AB046841	2.3e-118	44.6	KIAA1621
AB002343	6.4e-105	43.6	KIAA0345
AB053446	3.3e-58	33.7	KIAA1773
AB046782	1.7e-51	36.8	KIAA1562

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	151	170	PR00205	Cadherin
	IPR002126	320	349	PR00205	Cadherin
	IPR002126	392	404	PR00205	Cadherin
	IPR002126	509	528	PR00205	Cadherin
	IPR002126	528	541	PR00205	Cadherin
	IPR002126	588	614	PR00205	Cadherin
	IPR002126	622	639	PR00205	Cadherin
HMMPfam	IPR013164	107	190	PF08266	Cadherin
	IPR002126	235	311	PF00028	Cadherin
	IPR002126	325	416	PF00028	Cadherin
	IPR002126	430	521	PF00028	Cadherin
	IPR002126	535	631	PF00028	Cadherin
	IPR002126	660	743	PF00028	Cadherin
HMMSmart	IPR002126	97	209	SM00112	Cadherin
	IPR002126	233	318	SM00112	Cadherin
	IPR002126	342	423	SM00112	Cadherin
	IPR002126	447	528	SM00112	Cadherin
	IPR002126	552	638	SM00112	Cadherin
	IPR002126	669	747	SM00112	Cadherin
ProfileScan	IPR002126	107	211	PS50268	Cadherin
	IPR002126	212	320	PS50268	Cadherin
	IPR002126	321	425	PS50268	Cadherin
	IPR002126	434	530	PS50268	Cadherin
	IPR002126	531	640	PS50268	Cadherin
	IPR002126	657	760	PS50268	Cadherin
ScanRegExp	IPR002126	199	209	PS00232	Cadherin
	IPR002126	308	318	PS00232	Cadherin
	IPR002126	413	423	PS00232	Cadherin
	IPR002126	518	528	PS00232	Cadherin
	IPR002126	628	638	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	769	LYLVVAVAAISCVFLAFVAVLLG	791	PRIMARY	23

Primer_f	TTCATCTGGGGCCTTATTTCC
Primer_r	AATATGGAGAAATGGGTAGGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCATCTGGGGCCTTATTTCC
Primer_r	AATATGGAGAAATGGGTAGGC
PCR product length	109 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles