KIAA1562

Product ID	ORK00864
Accession No	AB046782
Description	protocadherin 18, transcript variant 1
Clone name	fh20205
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5119 bp) Predicted protein sequence (1136 aa)
HaloTag ORF Clone	FHC00864
Flexi ORF Clone	FXC00864
Source	Human fetal brain
Rouge ID	mKIAA1562 by Kazusa Mouse cDNA Project

Length: 5119 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	1324 bp
Genome contig ID	gi89161207r_138560310
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTCTGTCAGTGAAAATAAAAGAAAAATTAAAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCTAAGGAACTGTCTATAAGTCAGAGTCCTGTTCCTACATATTTGTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	r	138660310	138673079	4	99.6	Perfect prediction

Length: 1136 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCL0	100.0	Protocadherin-1...	Homo sapiens
BAF84707	99.9	unnamed protein...	Homo sapiens
XP_001915698	98.0	protocadherin 1...	Equus caballus
A7MB46	97.2	Protocadherin-1...	Bos taurus
EAX05140	100.0	protocadherin 1...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002343	1.2e-65	35.0	KIAA0345
AB037821	3.9e-61	37.8	KIAA1400
AB002325	1.8e-39	36.8	KIAA0327
AB011160	2e-39	38.0	KIAA0588
AB046841	3.3e-30	34.6	KIAA1621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	76	95	PR00205	Cadherin
	IPR002126	247	276	PR00205	Cadherin
	IPR002126	320	332	PR00205	Cadherin
	IPR002126	445	464	PR00205	Cadherin
	IPR002126	464	477	PR00205	Cadherin
	IPR002126	524	550	PR00205	Cadherin
	IPR002126	559	576	PR00205	Cadherin
HMMPfam	IPR013164	29	115	PF08266	Cadherin
	IPR002126	143	238	PF00028	Cadherin
	IPR002126	252	346	PF00028	Cadherin
	IPR002126	372	457	PF00028	Cadherin
	IPR002126	471	568	PF00028	Cadherin
	IPR002126	587	667	PF00028	Cadherin
HMMSmart	IPR002126	52	136	SM00112	Cadherin
	IPR002126	160	245	SM00112	Cadherin
	IPR002126	269	353	SM00112	Cadherin
	IPR002126	383	464	SM00112	Cadherin
	IPR002126	488	575	SM00112	Cadherin
	IPR002126	604	685	SM00112	Cadherin
ProfileScan	IPR002126	27	138	PS50268	Cadherin
	IPR002126	139	247	PS50268	Cadherin
	IPR002126	248	355	PS50268	Cadherin
	IPR002126	370	466	PS50268	Cadherin
	IPR002126	467	577	PS50268	Cadherin
	IPR002126	583	689	PS50268	Cadherin
ScanRegExp	IPR002126	126	136	PS00232	Cadherin
	IPR002126	235	245	PS00232	Cadherin
	IPR002126	343	353	PS00232	Cadherin
	IPR002126	454	464	PS00232	Cadherin
	IPR002126	565	575	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	9	MHFRFVFALLIVSFNHDVLGKNL	31	SECONDARY	23
	2	675	CMIFEYAESVTSTAMTSVSQASL	697	SECONDARY	23
	3	700	SMIIIISLGAICAVLLVIMVLFA	722	PRIMARY	23

Primer_f	AATGATGGGAAACACGAACTC
Primer_r	GCAATGCCAGTTCTTTCAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-