KIAA0341

Product ID	ORK00510
Accession No	AB002339
Description	NEDD4 binding protein 3
Clone name	hg01438
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5721 bp) Predicted protein sequence (546 aa)
HaloTag ORF Clone	FHC00510
Flexi ORF Clone	FXC00510
Source	Human adult brain
Rouge ID	mKIAA0341 by Kazusa Mouse cDNA Project

Length: 5721 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4078 bp
Genome contig ID	gi51511721f_177379183
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTAGAAAATCTTACACAATAAAGGACTTCAAAAT
Flanking genome sequence (106505 - 106554)	----+--------+--------+--------+--------+----* AAGGGTAAGGAAGGATGCTTTAACAAGCGGTGCTGGGATAACTGGATAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	f	177479183	177485686	4	99.0	Perfect prediction

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09710	6e-182	100.0	NEDD4-binding p...	synthetic construct
O15049	3.2e-181	99.8	NEDD4-binding p...	Homo sapiens
AAH53323	6.6e-181	99.6	Nedd4 binding p...	Homo sapiens
XP_001146257	2.2e-180	99.3	Nedd4 binding p...	Pan troglodytes
XP_001093839	2.4e-173	95.8	Nedd4 binding p...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011124	3.5e-09	31.8	KIAA0552
AB058716	8.8e-06	32.4	KIAA1813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009638	368	529	PF06818	Fez1

Primer_f	TCTATTTCTGGCTCTTCATTC
Primer_r	GATCTGCTTTCACAATAACCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCTATTTCTGGCTCTTCATTC
Primer_r	GATCTGCTTTCACAATAACCG
PCR product length	176 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles