KIAA0399

Product ID	ORK01083
Accession No	AB007859
Description	zinc finger, ZZ-type with EF-hand domain 1
Clone name	hg00651s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11394 bp) Predicted protein sequence (2982 aa)
Flexi ORF Clone	FXC01083
Source	Human adult brain
Rouge ID	mKIAA0399 by Kazusa Mouse cDNA Project
Note	We replaced hg00651 and hg00651s1, former representative clones for KIAA0399 with hg00651s2. (2002/5/10,2005/08/06)

Length: 11394 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2444 bp
Genome contig ID	gi51511734r_3754489
PolyA signal sequence (AATATA,-31)	+--------+--------+----*----+---- AAGAAATATATTGTACAAATTCTATATAATAAGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGCCTGTGTGTGGACTGGTCTCTCCCTCCTCCCTCCGCCCCGCCGTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	3854489	3993002	55	99.7	Perfect prediction

Length: 2982 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_511813	99.6	zinc finger, ZZ...	Pan troglodytes
O43149	100.0	Zinc finger ZZ-...	Homo sapiens
NP_055928	99.9	zinc finger, ZZ...	Homo sapiens
XP_001117691	97.8	similar to zinc...	Macaca mulatta
XP_869342	91.8	similar to Zinc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38548	1.5e-08	42.4	KIAA0076
AB014608	7.9e-08	40.9	KIAA0708

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002048	136	164	PF00036	Calcium-binding EF-hand
	IPR004939	253	418	PF03256	Anaphase-promoting complex subunit 10
	IPR000433	1798	1846	PF00569	Zinc finger
	IPR000433	1847	1891	PF00569	Zinc finger
HMMSmart	IPR002048	136	164	SM00054	Calcium-binding EF-hand
	IPR000433	1798	1846	SM00291	Zinc finger
	IPR000433	1847	1891	SM00291	Zinc finger
ProfileScan	IPR002048	132	167	PS50222	Calcium-binding EF-hand
	IPR000433	1798	1848	PS50135	Zinc finger
	IPR000433	1847	1893	PS50135	Zinc finger
ScanRegExp	IPR000433	1853	1879	PS01357	Zinc finger

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2157	TLGLLGQLIIRLLPAEVDAAVIK	2179	SECONDARY	23
SOSUI2	2	2262	NIFTLLVLVGFPQVLCVGTRCVY	2284	PRIMARY	23

Primer_f	GAAAATACGTCACTCCTCTCG
Primer_r	AAGTCCCGCAGAGCAAAGGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GAAAATACGTCACTCCTCTCG
Primer_r	AAGTCCCGCAGAGCAAAGGTG
PCR product length	115 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles