KIAA0420

Product ID	ORK00532
Accession No	AB007880
Description	SEC14-like lipid binding 5
Clone name	fg02987
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6453 bp) Predicted protein sequence (756 aa)
HaloTag ORF Clone	FHC00532
Flexi ORF Clone	FXC00532
Source	Human fetal brain
Note	We replaced hh01118, former representative clones for KIAA0420 with fg02987. (2001/5/29)

Length: 6453 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4182 bp
Genome contig ID	gi51511732f_4848319
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGCTCCAACACGAGTTCGTAAACTTTCTTAAAAT
Flanking genome sequence (160837 - 160886)	----+--------+--------+--------+--------+----* ACTGAGGTTTTTTGTGTGTGTGTTTTCTTTGTTTTTTCAGCTCATCAGCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	4948319	5009154	16	99.3	Perfect prediction

Length: 756 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001098962	95.4	SEC14 (S. cerev...	Macaca mulatta
O43304	100.0	SEC14-like prot...	Homo sapiens
XP_547140	91.1	similar to SEC1...	Canis lupus fam...
AAI57908	88.1	SEC14-like 5 (S...	Mus musculus
XP_220173	88.1	similar to SEC1...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033012	7.1e-35	33.9	KIAA1186

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001071	326	348	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
	IPR001071	459	480	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
	IPR001071	492	511	PR00180	Cellular retinaldehyde binding/alpha-tocopherol transport
HMMPfam	IPR006797	77	233	PF04707	MSF1
	IPR008273	293	360	PF03765	Cellular retinaldehyde-binding/triple function
	IPR001251	375	563	PF00650	Cellular retinaldehyde-binding/triple function
HMMSmart	IPR001251	366	539	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR006797	62	235	PS50904	MSF1
	IPR001251	366	542	PS50191	Cellular retinaldehyde-binding/triple function
	IPR009038	569	713	PS50866	GOLD

Primer_f	TTCTTGAACGAGCCCACGGGA
Primer_r	GTTTGCCTGATCACTTGCTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTCTTGAACGAGCCCACGGGA
Primer_r	GTTTGCCTGATCACTTGCTCC
PCR product length	104 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles