Order Kazusa clone(s) from : ![]() |
Product ID | ORK07435 |
---|---|
Accession No | AB007885 |
Description | zinc finger, MYM-type 4 |
Clone name | hh01272 |
Vector information | |
cDNA sequence | DNA sequence (6108 bp) Predicted protein sequence (1270 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0425
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010507 | 84 | 124 | PF06467 | Zinc finger |
IPR010507 | 136 | 179 | PF06467 | Zinc finger | |
IPR010507 | 186 | 221 | PF06467 | Zinc finger | |
IPR010507 | 232 | 266 | PF06467 | Zinc finger | |
IPR010507 | 276 | 314 | PF06467 | Zinc finger | |
IPR010507 | 322 | 353 | PF06467 | Zinc finger | |
IPR010507 | 430 | 464 | PF06467 | Zinc finger | |
IPR010507 | 471 | 510 | PF06467 | Zinc finger | |
IPR010507 | 517 | 551 | PF06467 | Zinc finger | |
HMMSmart | IPR011017 | 63 | 99 | SM00746 | TRASH |
IPR011017 | 111 | 151 | SM00746 | TRASH | |
IPR011017 | 163 | 201 | SM00746 | TRASH | |
IPR011017 | 208 | 247 | SM00746 | TRASH | |
IPR011017 | 253 | 291 | SM00746 | TRASH | |
IPR011017 | 301 | 337 | SM00746 | TRASH | |
IPR011017 | 409 | 445 | SM00746 | TRASH | |
IPR011017 | 451 | 486 | SM00746 | TRASH | |
IPR011017 | 494 | 532 | SM00746 | TRASH | |
IPR011017 | 538 | 573 | SM00746 | TRASH | |
ScanRegExp | IPR001545 | 211 | 217 | PS00261 | Gonadotropin |
![]() |
---|
Primer_f | TTCTGTGGTTTCTGTAAGGGG |
---|---|
Primer_r | AGTGTAGCTGTTGATGTGTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCTGTGGTTTCTGTAAGGGG |
Primer_r | AGTGTAGCTGTTGATGTGTGC |
PCR product length | 95 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |