Order Kazusa clone(s) from : ![]() |
Product ID | ORK00524 |
---|---|
Accession No | AB002383 |
Description | zinc finger, MYM-type 3, transcript variant 2 |
Clone name | hh00802 |
Vector information | |
cDNA sequence | DNA sequence (5492 bp) Predicted protein sequence (1380 aa) |
HaloTag ORF Clone |
FHC00524
![]() |
Flexi ORF Clone | FXC00524 |
Source | Human adult brain |
Rouge ID |
mKIAA0385
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010507 | 342 | 376 | PF06467 | Zinc finger |
IPR010507 | 388 | 432 | PF06467 | Zinc finger | |
IPR010507 | 439 | 474 | PF06467 | Zinc finger | |
IPR010507 | 487 | 521 | PF06467 | Zinc finger | |
IPR010507 | 531 | 569 | PF06467 | Zinc finger | |
IPR010507 | 577 | 614 | PF06467 | Zinc finger | |
IPR010507 | 622 | 656 | PF06467 | Zinc finger | |
IPR010507 | 663 | 702 | PF06467 | Zinc finger | |
IPR010507 | 709 | 743 | PF06467 | Zinc finger | |
HMMSmart | IPR011017 | 321 | 357 | SM00746 | TRASH |
IPR011017 | 363 | 403 | SM00746 | TRASH | |
IPR011017 | 419 | 454 | SM00746 | TRASH | |
IPR011017 | 461 | 502 | SM00746 | TRASH | |
IPR011017 | 508 | 546 | SM00746 | TRASH | |
IPR011017 | 556 | 592 | SM00746 | TRASH | |
IPR011017 | 601 | 637 | SM00746 | TRASH | |
IPR011017 | 643 | 678 | SM00746 | TRASH | |
IPR011017 | 689 | 724 | SM00746 | TRASH | |
IPR011017 | 730 | 765 | SM00746 | TRASH |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 872 | PQVIVLPIPVPIFVPVPMHLYC | 893 | PRIMARY | 22 | 2 | 895 | KVPVPFSMPIPVPVPMFLPTTLE | 917 | SECONDARY | 23 |
---|
![]() |
---|
Primer_f | AGCCTCAACCCAAGTCAGAAG |
---|---|
Primer_r | CTCTCTGCCATCTTAGGTTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGCCTCAACCCAAGTCAGAAG |
Primer_r | CTCTCTGCCATCTTAGGTTGC |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |