Gene/Protein Characteristic Table for KIAA0433
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05426
Accession No AB007893
Description diphosphoinositol pentakisphosphate kinase 2
Clone name hh01945
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5814 bp)
Predicted protein sequence (1255 aa)
Source Human adult brain
Rouge ID mKIAA0433 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5814 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Features of the protein sequence
Description

Length: 1255 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O43314 0 100.0 Inositol hexaki...
Homo sapiens
XP_001137685 0 99.9 Histidine acid ...
Pan troglodytes
EAW49078 0 99.8 Histidine acid ...
Homo sapiens
XP_001098229 0 99.6 similar to Hist...
Macaca mulatta
Q5REW0 0 99.3 Inositol hexaki...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB002375 0 75.1 KIAA0377
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000560 391 906 PF00328 Histidine acid phosphatase
ScanRegExp IPR000560 392 406 PS00616 Histidine acid phosphatase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CGTCCACGCCTACAACTGAAG
Primer_r GCGAGCAGTTGTGAGATGGTC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f CGTCCACGCCTACAACTGAAG
Primer_r GCGAGCAGTTGTGAGATGGTC
PCR product length 108 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp