KIAA0377

Product ID	ORK00062
Accession No	AB002375
Description	diphosphoinositol pentakisphosphate kinase 1, transcript variant 7
Clone name	hh00412
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5544 bp) Predicted protein sequence (1412 aa)
HaloTag ORF Clone	FHC00062
Flexi ORF Clone	FXC00062
Source	Human adult brain
Rouge ID	mKIAA0377 by Kazusa Mouse cDNA Project

Length: 5544 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1197 bp
Genome contig ID	gi51511731r_41512967
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACATTATGAGTGCTCAATAAATATAAACTAATGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATGGTGGTGATGGATGATGGTGATGTCCTTGTGAATTCAAGAATGAATA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	r	41612967	41664386	29	99.6	Perfect prediction

Length: 1412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11175	100.0	histidine acid ...	synthetic construct
CAI46011	93.9	hypothetical pr...	Homo sapiens
CAD97968	93.9	hypothetical pr...	Homo sapiens
XP_510352	93.7	Histidine acid ...	Pan troglodytes
XP_535450	87.6	similar to CG14...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007893	3.4e-176	75.1	KIAA0433

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000560	396	912	PF00328	Histidine acid phosphatase
ScanRegExp	IPR000560	397	411	PS00616	Histidine acid phosphatase

Primer_f	GCACTCATAATGTTCCAGCCC
Primer_r	CAAAGACCAAACACTGCAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCACTCATAATGTTCCAGCCC
Primer_r	CAAAGACCAAACACTGCAGGG
PCR product length	166 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles