Order Kazusa clone(s) from : ![]() |
Product ID | ORK00062 |
---|---|
Accession No | AB002375 |
Description | diphosphoinositol pentakisphosphate kinase 1, transcript variant 7 |
Clone name | hh00412 |
Vector information | |
cDNA sequence | DNA sequence (5544 bp) Predicted protein sequence (1412 aa) |
HaloTag ORF Clone |
FHC00062
![]() |
Flexi ORF Clone | FXC00062 |
Source | Human adult brain |
Rouge ID |
mKIAA0377
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1197 bp |
---|---|
Genome contig ID | gi51511731r_41512967 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 15 | r | 41612967 | 41664386 | 29 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | GCACTCATAATGTTCCAGCCC |
---|---|
Primer_r | CAAAGACCAAACACTGCAGGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCACTCATAATGTTCCAGCCC |
Primer_r | CAAAGACCAAACACTGCAGGG |
PCR product length | 166 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |