Order Kazusa clone(s) from : ![]() |
Product ID | ORK04290 |
---|---|
Accession No | AB007894 |
Description | bassoon presynaptic cytomatrix protein |
Clone name | hh02165 |
Vector information | |
cDNA sequence | DNA sequence (5650 bp) Predicted protein sequence (1571 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0434
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 933 bp |
---|---|
Genome contig ID | gi89161205f_49569058 |
PolyA signal sequence (CATAAA,-27) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (111799 - 111848) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 49669058 | 49680855 | 8 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR008165 | 1454 | 1495 | PD003992 | Protein of unknown function GLTT |
![]() |
---|
Primer_f | CATCACAGGAGGAGAGGCAGC |
---|---|
Primer_r | TTCCCGCTCTAGCTCCTCTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACGCTGCTTTTCGGTGCTATG |
Primer_r | CCGTTTCCTTCACATTCCAGC |
PCR product length | 187 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |