Gene/Protein Characteristic Table for KIAA0559
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06293
Accession No AB011131
Description piccolo presynaptic cytomatrix protein
Clone name hh01510
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5639 bp)
Predicted protein sequence (1212 aa)
Source Human adult brain
Rouge ID mKIAA0559 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5639 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1212 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW76987 0 100.0 hCG19253, isofo...
Homo sapiens
NP_055325 0 100.0 piccolo isoform...
Homo sapiens
EAL24188 0 99.9 similar to Picc...
Homo sapiens
NP_149015 0 99.9 piccolo isoform...
Homo sapiens
XP_001160539 0 99.8 piccolo isoform...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007894 1.2e-19 33.0 KIAA0434
AB018294 0.0002 24.6 KIAA0751
AB002338 0.00043 26.9 KIAA0340
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001478 779 864 PF00595 PDZ/DHR/GLGF
IPR000008 986 1084 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR001478 788 867 SM00228 PDZ/DHR/GLGF
IPR000008 985 1099 SM00239 C2 calcium-dependent membrane targeting
ProfileScan IPR001478 773 867 PS50106 PDZ/DHR/GLGF
IPR000008 985 1084 PS50004 C2 calcium-dependent membrane targeting
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f TTATTACACAGGCACTTGGAG
Primer_r TGTGGATCAGTGTTTTTTGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name GeneBridge 4
Primer_f TTATTACACAGGCACTTGGAG
Primer_r TGTGGATCAGTGTTTTTTGCC
PCR product length 231 bp
PCR conditions 95 °C15 sec60 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp