Order Kazusa clone(s) from : ![]() |
Product ID | ORK06293 |
---|---|
Accession No | AB011131 |
Description | piccolo presynaptic cytomatrix protein |
Clone name | hh01510 |
Vector information | |
cDNA sequence | DNA sequence (5639 bp) Predicted protein sequence (1212 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0559
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001478 | 779 | 864 | PF00595 | PDZ/DHR/GLGF |
IPR000008 | 986 | 1084 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR001478 | 788 | 867 | SM00228 | PDZ/DHR/GLGF |
IPR000008 | 985 | 1099 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR001478 | 773 | 867 | PS50106 | PDZ/DHR/GLGF |
IPR000008 | 985 | 1084 | PS50004 | C2 calcium-dependent membrane targeting |
![]() |
---|
Primer_f | TTATTACACAGGCACTTGGAG |
---|---|
Primer_r | TGTGGATCAGTGTTTTTTGCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTATTACACAGGCACTTGGAG |
Primer_r | TGTGGATCAGTGTTTTTTGCC |
PCR product length | 231 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |