Order Kazusa clone(s) from : ![]() |
Product ID | ORK01118 |
---|---|
Accession No | AB018294 |
Description | regulating synaptic membrane exocytosis 2, transcript variant 3 |
Clone name | hk04424 |
Vector information | |
cDNA sequence | DNA sequence (3854 bp) Predicted protein sequence (1200 aa) |
HaloTag ORF Clone |
FHC01118
![]() |
Flexi ORF Clone | FXC01118 |
Source | Human adult brain |
Rouge ID |
mKIAA0751
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 39 bp |
---|---|
Genome contig ID | gi51511724f_104800664 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (532601 - 532650) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 8 | f | 104900664 | 105333263 | 21 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 626 | 638 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 655 | 668 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR001478 | 457 | 542 | PF00595 | PDZ/DHR/GLGF |
IPR000008 | 611 | 702 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1061 | 1148 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR001478 | 466 | 545 | SM00228 | PDZ/DHR/GLGF |
IPR000008 | 610 | 717 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1060 | 1163 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR001478 | 457 | 543 | PS50106 | PDZ/DHR/GLGF |
IPR000008 | 607 | 702 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1060 | 1148 | PS50004 | C2 calcium-dependent membrane targeting |
![]() |
Primer_f | TCCCACCTTCCTCCCTAGTAG |
---|---|
Primer_r | TGAACGAGAGTAAGAAGGTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |