Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK04975 |
---|---|
Accession No | AB018290 |
Description | extended synaptotagmin-like protein 1 |
Clone name | hk04143 |
Vector information | |
cDNA sequence | DNA sequence (4026 bp) Predicted protein sequence (1072 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000008 | 638 | 650 | PR00360 | C2 calcium-dependent membrane targeting |
IPR000008 | 662 | 675 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 684 | 692 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR000008 | 289 | 375 | PF00168 | C2 calcium-dependent membrane targeting |
IPR000008 | 438 | 526 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 617 | 703 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 768 | 845 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 956 | 1045 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 288 | 390 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 437 | 541 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 616 | 718 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 767 | 860 | SM00239 | C2 calcium-dependent membrane targeting | |
IPR000008 | 955 | 1060 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000008 | 289 | 375 | PS50004 | C2 calcium-dependent membrane targeting |
IPR000008 | 431 | 526 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 617 | 703 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 768 | 845 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 957 | 1045 | PS50004 | C2 calcium-dependent membrane targeting | |
ScanRegExp | IPR000276 | 849 | 865 | PS00237 | Rhodopsin-like GPCR superfamily |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 20 | LLVLIPVYLAGAVGLSVGFVLFG | 42 | PRIMARY | 23 |
---|
RT-PCR-ELISA |
Primer_f | TTCTACTGCTTTGATGGCTGG |
---|---|
Primer_r | GCTCCAAGACTGATATGCCAC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCTACTGCTTTGATGGCTGG |
Primer_r | GCTCCAAGACTGATATGCCAC |
PCR product length | 103 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |