Order Kazusa clone(s) from : ![]() |
Product ID | ORK00161 |
---|---|
Accession No | AB023202 |
Description | rabphilin 3A, transcript variant 1 |
Clone name | hj08038 |
Vector information | |
cDNA sequence | DNA sequence (4511 bp) Predicted protein sequence (697 aa) |
HaloTag ORF Clone |
FHC00161
![]() |
Flexi ORF Clone | FXC00161 |
Source | Human adult brain |
Rouge ID |
mKIAA0985
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2097 bp |
---|---|
Genome contig ID | gi89161190f_111614094 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (206973 - 207022) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | f | 111616764 | 111821065 | 23 | 99.6 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001565 | 557 | 572 | PR00399 | Synaptotagmin |
IPR001565 | 572 | 585 | PR00399 | Synaptotagmin | |
IPR000008 | 585 | 597 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 614 | 627 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR001565 | 629 | 644 | PR00399 | Synaptotagmin | |
IPR000008 | 638 | 646 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR001565 | 649 | 659 | PR00399 | Synaptotagmin | |
HMMPfam | IPR003315 | 4 | 276 | PF02318 | Rabphilin-3A effector |
IPR000008 | 412 | 501 | PF00168 | C2 calcium-dependent membrane targeting | |
IPR000008 | 570 | 658 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000008 | 411 | 516 | SM00239 | C2 calcium-dependent membrane targeting |
IPR000008 | 569 | 683 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR010911 | 47 | 163 | PS50916 | Rab-binding |
IPR000306 | 95 | 151 | PS50178 | Zinc finger | |
IPR000008 | 410 | 501 | PS50004 | C2 calcium-dependent membrane targeting | |
IPR000008 | 570 | 658 | PS50004 | C2 calcium-dependent membrane targeting |
![]() |
Primer_f | CTTATCTTTCCCCATTAGTCC |
---|---|
Primer_r | TGATTCCAGCGCCTACACCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CTTATCTTTCCCCATTAGTCC |
Primer_r | TGATTCCAGCGCCTACACCAG |
PCR product length | 128 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |