KIAA0985

Product ID	ORK00161
Accession No	AB023202
Description	rabphilin 3A, transcript variant 1
Clone name	hj08038
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4511 bp) Predicted protein sequence (697 aa)
HaloTag ORF Clone	FHC00161
Flexi ORF Clone	FXC00161
Source	Human adult brain
Rouge ID	mKIAA0985 by Kazusa Mouse cDNA Project

Length: 4511 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2097 bp
Genome contig ID	gi89161190f_111614094
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATGATGTAGCCAAAAATAAAGTAGGAGCATCCAAG
Flanking genome sequence (206973 - 207022)	----+--------+--------+--------+--------+----* AAAACGAGTGGTCTGCAGTTTTCCTTTCTGGTTTCTGCGAAGTCCTCCTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	111616764	111821065	23	99.6	Terminal No-hit

Length: 697 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y2J0	5.8e-192	100.0	Rabphilin-3A; E...	Homo sapiens
BAH14483	9.4e-192	99.9	unnamed protein...	Homo sapiens
XP_001110574	2.4e-190	99.0	rabphilin 3A ho...	Macaca mulatta
AAH17259	7e-190	99.3	Rabphilin 3A ho...	Homo sapiens
CAH92404	1.2e-189	98.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001565	557	572	PR00399	Synaptotagmin
	IPR001565	572	585	PR00399	Synaptotagmin
	IPR000008	585	597	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	614	627	PR00360	C2 calcium-dependent membrane targeting
	IPR001565	629	644	PR00399	Synaptotagmin
	IPR000008	638	646	PR00360	C2 calcium-dependent membrane targeting
	IPR001565	649	659	PR00399	Synaptotagmin
HMMPfam	IPR003315	4	276	PF02318	Rabphilin-3A effector
	IPR000008	412	501	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	570	658	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	411	516	SM00239	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	569	683	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR010911	47	163	PS50916	Rab-binding
	IPR000306	95	151	PS50178	Zinc finger
	IPR000008	410	501	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	570	658	PS50004	C2 calcium-dependent membrane targeting

Primer_f	CTTATCTTTCCCCATTAGTCC
Primer_r	TGATTCCAGCGCCTACACCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTTATCTTTCCCCATTAGTCC
Primer_r	TGATTCCAGCGCCTACACCAG
PCR product length	128 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles