KIAA1228

Product ID	ORK04976
Accession No	AB033054
Description	extended synaptotagmin-like protein 2
Clone name	fh05620s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5742 bp) Predicted protein sequence (843 aa)
Source	Human fetal brain
Note	We replaced fh05620, former representative clones for KIAA1228 with fh05620s1. (2002/5/10)

Length: 5742 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3208 bp
Genome contig ID	gi89161213r_158116450
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CATGTATTTATTCAATAAAACCTTTATGTTAGCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTCGTGATTTGTTTTTCTCTGTCTTTTGAAGGGAGGTGTTCAGTGTGCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	158216450	158314949	23	99.3	Perfect prediction

Length: 843 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
A0FGR8	100.0	Extended synapt...	Homo sapiens
EAX04591	100.0	family with seq...	Homo sapiens
EAX04590	99.9	family with seq...	Homo sapiens
XP_001083514	98.1	similar to fami...	Macaca mulatta
EDL33467	91.9	DNA segment, Ch...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018290	1.3e-78	37.1	KIAA0747
AB023202	5.7e-05	30.3	KIAA0985
AB046817	6.1e-05	32.6	KIAA1597
AB018294	0.0005	23.1	KIAA0751

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	330	342	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	354	367	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	376	384	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR000008	309	395	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	460	539	PF00168	C2 calcium-dependent membrane targeting
	IPR000008	725	814	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	308	410	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	459	554	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	724	829	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	309	395	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	445	539	PS50004	C2 calcium-dependent membrane targeting
	IPR000008	723	814	PS50004	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	24	GGVLSVELPGLLAQLARSFALLL	46	SECONDARY	23
SOSUI2	2	50	ALGYLGLSFSWVLLALALLAWC	71	PRIMARY	22

Primer_f	ATCTATAAAGCAGCAGCACTC
Primer_r	ATTGTGTCTACTCTGCCTAAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-