Order Kazusa clone(s) from : ![]() |
Product ID | ORK00536 |
---|---|
Accession No | AB007896 |
Description | prolyl endopeptidase-like, transcript variant 6 |
Clone name | hj00011 |
Vector information | |
cDNA sequence | DNA sequence (4661 bp) Predicted protein sequence (689 aa) |
Flexi ORF Clone | FXC00536 |
Source | Human adult brain |
Rouge ID |
mKIAA0436
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2591 bp |
---|---|
Genome contig ID | gi89161199r_44299407 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 44399407 | 44442127 | 14 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002470 | 435 | 453 | PR00862 | Peptidase S9A |
IPR002470 | 461 | 485 | PR00862 | Peptidase S9A | |
IPR002470 | 489 | 508 | PR00862 | Peptidase S9A | |
IPR002470 | 519 | 539 | PR00862 | Peptidase S9A | |
IPR002470 | 578 | 593 | PR00862 | Peptidase S9A | |
IPR002470 | 596 | 618 | PR00862 | Peptidase S9A | |
HMMPfam | IPR004106 | 39 | 393 | PF02897 | Peptidase S9A |
IPR001375 | 450 | 612 | PF00326 | Peptidase S9 |
![]() |
---|
Primer_f | ACTTACCGGGCACTTCTTATG |
---|---|
Primer_r | TGTTCTTTAGGGGTAGGTTCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACTTACCGGGCACTTCTTATG |
Primer_r | TGTTCTTTAGGGGTAGGTTCC |
PCR product length | 204 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |