KIAA0437

Product ID	ORK00076
Accession No	AB007897
Description	SET binding protein 1, transcript variant 1
Clone name	hj00203s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hj00203s1 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (6197 bp) Predicted protein sequence (1605 aa)
HaloTag ORF Clone	FHC00076
Flexi ORF Clone	FXC00076
Source	Human adult brain
Rouge ID	mKIAA0437 by Kazusa Mouse cDNA Project
Note	We replaced hj00203, former representative clones for KIAA0437 with hj00203s1. (2002/5/10)

Length: 6197 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1110 bp
Genome contig ID	gi51511735f_40414861
PolyA signal sequence (None)	+--------+--------+----*----+---- ATCTTTTTCATTCAAATAATTGTCATAGGTTGTTC
Flanking genome sequence (483912 - 483961)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAGGAAACAAAAACACAATAGAAGTCCATTATCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	18	f	40514861	40898771	6	99.4	Perfect prediction

Length: 1605 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX01441	100.0	SET binding pro...	Homo sapiens
NP_056374	99.9	SET binding pro...	Homo sapiens
XP_512106	99.7	SET binding pro...	Pan troglodytes
Q9Y6X0	100.0	SET-binding pro...	Homo sapiens
XP_001497935	95.5	similar to SET ...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037841	7.4e-15	32.1	KIAA1420

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000637	593	605	PF02178	HMG-I and HMG-Y
	IPR000637	1025	1037	PF02178	HMG-I and HMG-Y
	IPR000637	1460	1472	PF02178	HMG-I and HMG-Y
HMMSmart	IPR000637	593	605	SM00384	HMG-I and HMG-Y
	IPR000637	1025	1037	SM00384	HMG-I and HMG-Y
	IPR000637	1460	1472	SM00384	HMG-I and HMG-Y

Primer_f	TCCTTTGCCCATTGTACTTCC
Primer_r	ATAGCCTGGTTGACATCTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCCTTTGCCCATTGTACTTCC
Primer_r	ATAGCCTGGTTGACATCTGGG
PCR product length	254 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles