|
Order Kazusa clone(s) from : |
| Product ID | ORK00079 |
|---|---|
| Accession No | AB007916 |
| Description | solute carrier family 35, member E2B, transcript variant 2 |
| Clone name | fh17910 |
| Vector information | |
| cDNA sequence | DNA sequence (5272 bp) Predicted protein sequence (466 aa) |
|
HaloTag ORF Clone |
FHC00079
|
| Flexi ORF Clone | FXC00079 |
| Source | Human fetal brain |
| Rouge ID |
mKIAA0447
by Kazusa Mouse cDNA Project
|
| Note | We replaced hg00132, former representative clones for KIAA0447 with fh17910. (2005/08/06) |
Length: 5272 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 3613 bp |
|---|---|
| Genome contig ID | gi89161185r_1482803 |
| PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (165882 - 165833) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 1 | r | 1509475 | 1614041 | 11 | 98.7 | Terminal No-hit |
|
| 1 | r | 1640910 | 1667316 | 8 | 98.5 | Internal No-hit |
Length: 466 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR002110 | 84 | 96 | PR01415 | Ankyrin |
| IPR002110 | 354 | 366 | PR01415 | Ankyrin | |
| HMMPfam | IPR004853 | 285 | 430 | PF03151 | Protein of unknown function DUF250 |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 138 | LYLTLWFFFSFCTLFLNKYILSL | 160 | PRIMARY | 23 | 2 | 169 | GAVQMLSTTVIGCVKTLVPCCLY | 191 | SECONDARY | 23 | 3 | 205 | MTMLFVGLMRFATVVLGLVSLKN | 227 | SECONDARY | 23 | 4 | 259 | LVNLSLIPVMGGLALCTATEISF | 281 | SECONDARY | 23 | 5 | 353 | YNQDVVLLLLTDGVLFHLQSITA | 375 | SECONDARY | 23 | 6 | 401 | LSVIVFGNKITSLSAVGTALVTV | 423 | PRIMARY | 23 |
|---|
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ACTTACCACCACAGCAGAATC |
| Primer_r | GTTTTGCATGTGACCTATTTC |
| PCR product length | 106 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |