KIAA0466

Product ID	ORK00543
Accession No	AB007935
Description	immunoglobulin superfamily, member 3, transcript variant 2
Clone name	pg00625
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6588 bp) Predicted protein sequence (1214 aa)
Flexi ORF Clone	FXC00543
Source	Human brain (hippocampus)
Rouge ID	mKIAA0466 by Kazusa Mouse cDNA Project
Note	We replaced hg01451, former representative clones for KIAA0466 with pg00625. (2001/5/29)

Length: 6588 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2903 bp
Genome contig ID	gi89161185r_116818554
PolyA signal sequence (AGTAAA,-19)	+--------+--------+----*----+---- CACTTCAGAGACCTGTAGTAAATTATGTTGAAAAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACGGCTGTTTACATTTACTGCAGTCTTCTATCCTTCTTTCCCCTTACTAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	116918554	117010571	10	100.0	Perfect prediction

Length: 1214 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O75054	100.0	Immunoglobulin ...	Homo sapiens
AAI10652	99.8	Immunoglobulin ...	Homo sapiens
ACE86759	99.7	immunoglobulin ...	synthetic construct
ACE87446	99.6	immunoglobulin ...	synthetic construct
XP_540257	93.2	similar to immu...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037857	2e-28	26.3	KIAA1436

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	40	162	PF07686	Immunoglobulin V-set
	IPR013106	165	266	PF07686	Immunoglobulin V-set
	IPR013151	315	398	PF00047	Immunoglobulin
	IPR013151	445	533	PF00047	Immunoglobulin
	IPR013106	699	804	PF07686	Immunoglobulin V-set
	IPR013151	851	940	PF00047	Immunoglobulin
	IPR013151	1084	1102	PF00047	Immunoglobulin
HMMSmart	IPR003599	47	162	SM00409	Immunoglobulin subtype
	IPR003598	53	147	SM00408	Immunoglobulin subtype 2
	IPR003596	57	142	SM00406	Immunoglobulin V-set
	IPR003599	172	295	SM00409	Immunoglobulin subtype
	IPR003596	182	268	SM00406	Immunoglobulin V-set
	IPR003599	307	425	SM00409	Immunoglobulin subtype
	IPR003598	313	403	SM00408	Immunoglobulin subtype 2
	IPR003599	437	559	SM00409	Immunoglobulin subtype
	IPR003598	443	538	SM00408	Immunoglobulin subtype 2
	IPR003596	447	533	SM00406	Immunoglobulin V-set
	IPR003599	573	694	SM00409	Immunoglobulin subtype
	IPR003599	706	831	SM00409	Immunoglobulin subtype
	IPR003596	716	804	SM00406	Immunoglobulin V-set
	IPR003599	843	967	SM00409	Immunoglobulin subtype
	IPR003598	849	945	SM00408	Immunoglobulin subtype 2
	IPR003599	979	1129	SM00409	Immunoglobulin subtype
ProfileScan	IPR007110	26	158	PS50835	Immunoglobulin-like
	IPR007110	163	268	PS50835	Immunoglobulin-like
	IPR007110	296	406	PS50835	Immunoglobulin-like
	IPR007110	421	559	PS50835	Immunoglobulin-like
	IPR007110	696	823	PS50835	Immunoglobulin-like
	IPR007110	833	965	PS50835	Immunoglobulin-like
	IPR007110	969	1117	PS50835	Immunoglobulin-like

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	18	AADMKCFFPVLSCLAVLGVVSAQ	40	SECONDARY	23
SOSUI2	2	1144	ALFYFVFFYPFPIFGILIITILL	1166	PRIMARY	23

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ACTTGCTACAGAAACACCCGG
Primer_r	CGGAGGAAAACTGCTGAATAC
PCR product length	136 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles