KIAA0482

Product ID	ORK00548
Accession No	AB088477
Description	period circadian clock 1
Clone name	hj01880
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4649 bp) Predicted protein sequence (1332 aa)
HaloTag ORF Clone	FHC00548
Flexi ORF Clone	FXC00548
Source	Human adult brain
Rouge ID	mKIAA0482 by Kazusa Mouse cDNA Project

Length: 4649 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	596 bp
Genome contig ID	gi51511734r_7884515
PolyA signal sequence (GATAAA,-12)	+--------+--------+----*----+---- TTACTACTTTTTTAATACAAAAAGATAAAAACGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CAGGACTTTGTGGAATGAAGTTTGGGGTTGGGGTGAGGGGAGCATGTCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	7984515	7996420	23	99.8	Perfect prediction

Length: 1332 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001118146	97.3	similar to peri...	Macaca mulatta
AAC51765	100.0	Rigui [Homo sap...	Homo sapiens
O15534	99.9	Period circadia...	Homo sapiens
BAF83750	99.8	unnamed protein...	Homo sapiens
XP_001167357	99.0	period 1 isofor...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002345	4.1e-39	44.4	KIAA0347
AB047686	4.1e-36	37.8	KIAA1779

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013655	412	507	PF08447	PAS fold-3
HMMSmart	IPR000014	250	317	SM00091	PAS
HMMSmart	IPR000014	390	456	SM00091	PAS
ProfileScan	IPR000014	415	458	PS50112	PAS

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	GAACTCAGATGTGGCTAGACC
Primer_r	TGTCAGCAACTTTGTCCAGGG
PCR product length	209 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles