KIAA1779

Product ID	ORK02054
Accession No	AB047686
Description	period circadian clock 3, transcript variant 4
Clone name	hg04229
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6278 bp) Predicted protein sequence (1233 aa)
HaloTag ORF Clone	FHC02054
Flexi ORF Clone	FXC02054
Source	Human adult brain
Rouge ID	mKIAA1779 by Kazusa Mouse cDNA Project

Length: 6278 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	2421 bp
Genome contig ID	gi89161185f_7667301
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- AAAACAACAAATAAACTCTGTACATGTAAAACGTG
Flanking genome sequence (160524 - 160573)	----+--------+--------+--------+--------+----* AGAAATTGTCCTGCCCTGTGTCAACAAATCTTTGAATGTGTATTCTGTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	7767301	7827823	21	99.4	Perfect prediction

Length: 1233 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB32925	100.0	period (Drosoph...	Homo sapiens
AAI46782	100.0	PER3 protein [H...	Homo sapiens
CAI21435	99.8	period homolog ...	Homo sapiens
P56645	99.2	Period circadia...	Homo sapiens
CAB76084	99.1	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB088477	1.9e-38	37.2	KIAA0482
AB002345	3.4e-33	37.4	KIAA0347

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013655	308	404	PF08447	PAS fold-3
HMMSmart	IPR000014	139	211	SM00091	PAS
HMMSmart	IPR000014	286	352	SM00091	PAS
ProfileScan	IPR000014	308	354	PS50112	PAS

Primer_f	TGGGTCAGCAGCTCTACATTG
Primer_r	CTCATCGTTCCTCAAATCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-