KIAA0496

Product ID	ORK04696
Accession No	AB007965
Description	Cysteine/histidine-rich protein 1 (Fragment).
Clone name	hg00144
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6151 bp) Predicted protein sequence (218 aa)
Source	Human adult brain
Rouge ID	mKIAA0496 by Kazusa Mouse cDNA Project

Length: 6151 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	546 bp
Genome contig ID	gi51511724r_145547318
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- CTGTATCAGAACCAATAAAGTGCACTTGTTCTCGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCGCATCCTGTCTGTGTGTCTGCTTACCCCGCCCTGGGGGACACCCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	8	r	145647318	145654119	2	99.0	Perfect prediction

Length: 218 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD18724	6.5e-68	100.0	FLJ00352 protei...	Homo sapiens
XP_001714958	2.7e-64	100.0	hypothetical pr...	Homo sapiens
XP_001714266	2.9e-64	100.0	hypothetical pr...	Homo sapiens
EAW82090	3.4e-64	98.0	cysteine/histid...	Homo sapiens
XP_001092948	5.9e-64	97.4	similar to cyst...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001293	42	100	PS50145	Zinc finger

Primer_f
Primer_r
PCR conditions	°C sec °C sec cycles

Panel name	GeneBridge 4
Primer_f	ATGCAGTCCAGGTGTGAAAGG
Primer_r	TAAAGGGGAGCTAGATGGGCG
PCR product length	141 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles