Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05530 |
---|---|
Accession No | AB011094 |
Description | IQ motif and Sec7 domain 2, transcript variant 1 |
Clone name | hg01393 |
Vector information | |
cDNA sequence | DNA sequence (6022 bp) Predicted protein sequence (1555 aa) |
HaloTag ORF Clone |
FHC05530
|
Flexi ORF Clone | FXC05530 |
Source | Human adult brain |
Rouge ID |
mKIAA0522
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1354 bp |
---|---|
Genome contig ID | gi89161218r_53178784 |
PolyA signal sequence (CATAAA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (288464 - 288415) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000048 | 415 | 435 | PF00612 | IQ calmodulin-binding region |
IPR000904 | 817 | 1008 | PF01369 | SEC7-like | |
HMMSmart | IPR000904 | 817 | 1008 | SM00222 | SEC7-like |
IPR001849 | 1039 | 1150 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR000048 | 414 | 443 | PS50096 | IQ calmodulin-binding region |
IPR000904 | 813 | 1006 | PS50190 | SEC7-like |
RT-PCR |
---|
Primer_f | GAGCACAAGGTCTTTTATGAG |
---|---|
Primer_r | ATGGACCCTGGCTGTACGAAG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAGCACAAGGTCTTTTATGAG |
Primer_r | ATGGACCCTGGCTGTACGAAG |
PCR product length | 164 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |