Gene/Protein Characteristic Table for KIAA0522
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05530
Accession No AB011094
Description IQ motif and Sec7 domain 2, transcript variant 1
Clone name hg01393
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6022 bp)
Predicted protein sequence (1555 aa)
Flexi ORF Clone FXC05530
Source Human adult brain
Rouge ID mKIAA0522 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6022 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 1354 bp
Genome contig ID gi89161218r_53178784
PolyA signal sequence
(CATAAA,-31)
+----*----+----*----+----*----+----
GCCTCATAAAAGACCTTGTGCTCAAAAAAAAAAAC
Flanking genome sequence
(288464 - 288415)
----+----*----+----*----+----*----+----*----+----*
CTAAGGCCCCTGCCTTATTAATGATAGAGAGCAGAGAGGGAAGAGAGGTA
Features of the protein sequence
Description

Length: 1555 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW93147 0 100.0 hCG19160 [Homo ...
Homo sapiens
Q5JU85 0 99.3 IQ motif and SE...
Homo sapiens
Q5DU25 0 98.3 IQ motif and SE...
Mus musculus
BAF49453 0 98.4 ARF6 guanine nu...
Mus musculus
XP_001914847 0 95.8 similar to IQ m...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029033 1.9e-31 44.0 KIAA1110
AB018306 5.6e-30 62.5 KIAA0763
D87435 4e-05 34.6 KIAA0248
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000048 415 435 PF00612 IQ calmodulin-binding region
IPR000904 817 1008 PF01369 SEC7-like
HMMSmart IPR000904 817 1008 SM00222 SEC7-like
IPR001849 1039 1150 SM00233 Pleckstrin-like
ProfileScan IPR000048 414 443 PS50096 IQ calmodulin-binding region
IPR000904 813 1006 PS50190 SEC7-like
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GAGCACAAGGTCTTTTATGAG
Primer_r ATGGACCCTGGCTGTACGAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. X
Experimental conditions
Panel name GeneBridge 4
Primer_f GAGCACAAGGTCTTTTATGAG
Primer_r ATGGACCCTGGCTGTACGAAG
PCR product length 164 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp