Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05608 |
---|---|
Accession No | AB011105 |
Description | laminin, alpha 5 |
Clone name | hg03784 |
Vector information | |
cDNA sequence | DNA sequence (5117 bp) Predicted protein sequence (1645 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0533
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002049 | 31 | 49 | PR00011 | EGF-like |
IPR002049 | 74 | 92 | PR00011 | EGF-like | |
HMMPfam | IPR002049 | 20 | 64 | PF00053 | EGF-like |
IPR009254 | 141 | 401 | PF06008 | Laminin I | |
IPR010307 | 582 | 712 | PF06009 | Laminin II | |
IPR012680 | 920 | 1049 | PF02210 | Laminin G | |
IPR012680 | 1103 | 1220 | PF02210 | Laminin G | |
IPR012680 | 1320 | 1449 | PF02210 | Laminin G | |
IPR012680 | 1499 | 1623 | PF02210 | Laminin G | |
HMMSmart | IPR002049 | 20 | 64 | SM00180 | EGF-like |
IPR002049 | 67 | 114 | SM00180 | EGF-like | |
IPR001791 | 708 | 858 | SM00282 | Laminin G | |
IPR001791 | 912 | 1049 | SM00282 | Laminin G | |
IPR001791 | 1095 | 1220 | SM00282 | Laminin G | |
IPR001791 | 1312 | 1449 | SM00282 | Laminin G | |
IPR001791 | 1491 | 1623 | SM00282 | Laminin G | |
ProfileScan | IPR002049 | 1 | 19 | PS50027 | EGF-like |
IPR002049 | 20 | 66 | PS50027 | EGF-like | |
IPR002049 | 67 | 116 | PS50027 | EGF-like | |
IPR001791 | 686 | 879 | PS50025 | Laminin G | |
IPR001791 | 891 | 1065 | PS50025 | Laminin G | |
IPR001791 | 1074 | 1242 | PS50025 | Laminin G | |
IPR001791 | 1290 | 1463 | PS50025 | Laminin G | |
IPR001791 | 1470 | 1642 | PS50025 | Laminin G | |
ScanRegExp | IPR001368 | 1 | 40 | PS00652 | TNFR/CD27/30/40/95 cysteine-rich region |
IPR013032 | 20 | 31 | PS00022 | EGF-like region | |
IPR013032 | 38 | 49 | PS00022 | EGF-like region | |
IPR002049 | 38 | 69 | PS01248 | EGF-like | |
IPR013032 | 81 | 92 | PS00022 | EGF-like region |
RT-PCR |
---|
Primer_f | AGTTGCAGGTGACCGAGAAGC |
---|---|
Primer_r | CATTCCCGCTTTTCATCACCG |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGTTGCAGGTGACCGAGAAGC |
Primer_r | CATTCCCGCTTTTCATCACCG |
PCR product length | 135 (0.4k) bp |
PCR conditions | 95 °C15 sec66 °C60 sec30 cycles |