Gene/Protein Characteristic Table for KIAA0815
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05965
Accession No AB011539
Description multiple EGF-like-domains 6
Clone name sh06087
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5456 bp)
Predicted protein sequence (1640 aa)
Source
Rouge ID mKIAA0815 by Kazusa Mouse cDNA Project
Note We replaced hg01805 and hj06848, former representative clones for KIAA0815 with sh06087. (2002/4/24,2005/08/06)
Features of the cloned cDNA sequence
Description

Length: 5456 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 531 bp
Genome contig ID gi89161185r_3296350
PolyA signal sequence
(None)		 
+----*----+----*----+----*----+----
GTACCATGTAAACCTAGGAAGGTAAAGGAGCAGGC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AACCTCCTCGTGGCCTGTGTGTTTGCTGTGTTACGTGGACTCTGTGTGGG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 1 r 3396350 3517919 37 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 1640 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAE19678 0 100.0 hypothetical pr...
 Homo sapiens
AAI46387 0 99.7 Multiple EGF-li...
 synthetic construct
XP_873582 0 82.0 similar to EGF-...
 Bos taurus
XP_001915428 0 81.9 multiple EGF-li...
 Equus caballus
CAM21839 0 77.3 multiple EGF-li...
 Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058677 4.8e-91 43.2 KIAA1781
AB058676 2.4e-86 42.5 KIAA1780
AB053450 5.7e-39 28.8 KIAA1776
D63483 1.3e-26 37.4 KIAA0149
AB067494 2.5e-21 32.2 KIAA1907
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002049 651 669 PR00011 EGF-like
IPR002049 739 757 PR00011 EGF-like
IPR002049 870 888 PR00011 EGF-like
HMMPfam IPR011489 133 193 PF07546 EMI
IPR006209 203 233 PF00008 EGF-like
IPR013091 236 275 PF07645 EGF calcium-binding
IPR006209 281 317 PF00008 EGF-like
IPR006209 323 358 PF00008 EGF-like
IPR013091 360 399 PF07645 EGF calcium-binding
IPR006209 410 445 PF00008 EGF-like
IPR013091 487 526 PF07645 EGF calcium-binding
IPR013111 643 669 PF07974 EGF
IPR013111 686 712 PF07974 EGF
IPR002049 866 907 PF00053 EGF-like
IPR002049 948 988 PF00053 EGF-like
IPR002049 992 1035 PF00053 EGF-like
IPR013111 1078 1104 PF07974 EGF
IPR013111 1121 1147 PF07974 EGF
IPR006209 1160 1190 PF00008 EGF-like
IPR002049 1207 1246 PF00053 EGF-like
IPR002049 1250 1290 PF00053 EGF-like
IPR013111 1294 1320 PF07974 EGF
IPR002049 1337 1365 PF00053 EGF-like
IPR002049 1423 1462 PF00053 EGF-like
IPR002049 1509 1548 PF00053 EGF-like
IPR002049 1552 1578 PF00053 EGF-like
HMMSmart IPR001881 194 234 SM00179 EGF-like calcium-binding
IPR006210 202 234 SM00181 EGF
IPR001881 236 276 SM00179 EGF-like calcium-binding
IPR006210 239 276 SM00181 EGF
IPR001881 277 318 SM00179 EGF-like calcium-binding
IPR006210 280 318 SM00181 EGF
IPR006210 322 359 SM00181 EGF
IPR001881 323 359 SM00179 EGF-like calcium-binding
IPR001881 360 400 SM00179 EGF-like calcium-binding
IPR006210 363 400 SM00181 EGF
IPR001881 407 446 SM00179 EGF-like calcium-binding
IPR006210 409 446 SM00181 EGF
IPR001881 447 484 SM00179 EGF-like calcium-binding
IPR006210 450 486 SM00181 EGF
IPR001881 487 527 SM00179 EGF-like calcium-binding
IPR006210 490 527 SM00181 EGF
IPR006210 594 627 SM00181 EGF
IPR006210 638 670 SM00181 EGF
IPR002049 643 682 SM00180 EGF-like
IPR006210 681 713 SM00181 EGF
IPR002049 686 725 SM00180 EGF-like
IPR006210 715 758 SM00181 EGF
IPR002049 729 770 SM00180 EGF-like
IPR006210 760 803 SM00181 EGF
IPR002049 774 815 SM00180 EGF-like
IPR006210 814 845 SM00181 EGF
IPR002049 819 857 SM00180 EGF-like
IPR006210 856 889 SM00181 EGF
IPR002049 861 901 SM00180 EGF-like
IPR006210 900 932 SM00181 EGF
IPR002049 905 944 SM00180 EGF-like
IPR006210 943 976 SM00181 EGF
IPR002049 948 988 SM00180 EGF-like
IPR006210 987 1019 SM00181 EGF
IPR002049 992 1031 SM00180 EGF-like
IPR006210 1030 1062 SM00181 EGF
IPR002049 1035 1074 SM00180 EGF-like
IPR006210 1073 1105 SM00181 EGF
IPR002049 1078 1117 SM00180 EGF-like
IPR006210 1116 1148 SM00181 EGF
IPR002049 1121 1160 SM00180 EGF-like
IPR006210 1150 1191 SM00181 EGF
IPR002049 1165 1203 SM00180 EGF-like
IPR006210 1202 1234 SM00181 EGF
IPR002049 1207 1246 SM00180 EGF-like
IPR006210 1245 1278 SM00181 EGF
IPR002049 1250 1290 SM00180 EGF-like
IPR006210 1289 1321 SM00181 EGF
IPR002049 1294 1333 SM00180 EGF-like
IPR006210 1332 1364 SM00181 EGF
IPR002049 1337 1376 SM00180 EGF-like
IPR006210 1375 1407 SM00181 EGF
IPR002049 1380 1419 SM00180 EGF-like
IPR006210 1418 1450 SM00181 EGF
IPR002049 1423 1462 SM00180 EGF-like
IPR006210 1452 1493 SM00181 EGF
IPR002049 1466 1505 SM00180 EGF-like
IPR006210 1504 1536 SM00181 EGF
IPR002049 1509 1548 SM00180 EGF-like
IPR006210 1547 1579 SM00181 EGF
IPR002049 1552 1599 SM00180 EGF-like
ProfileScan IPR011489 119 200 PS51041 EMI
IPR000742 199 234 PS50026 EGF-like
IPR000742 236 276 PS50026 EGF-like
IPR000742 313 359 PS50026 EGF-like
IPR000742 360 400 PS50026 EGF-like
IPR000742 487 527 PS50026 EGF-like
IPR000742 591 627 PS50026 EGF-like
IPR000742 635 670 PS50026 EGF-like
IPR000742 678 713 PS50026 EGF-like
IPR000742 811 845 PS50026 EGF-like
IPR000742 858 889 PS50026 EGF-like
IPR000742 897 932 PS50026 EGF-like
IPR000742 940 976 PS50026 EGF-like
IPR000742 984 1019 PS50026 EGF-like
IPR000742 1070 1105 PS50026 EGF-like
IPR000742 1113 1148 PS50026 EGF-like
IPR000742 1156 1191 PS50026 EGF-like
IPR000742 1199 1234 PS50026 EGF-like
IPR000742 1286 1321 PS50026 EGF-like
IPR000742 1329 1364 PS50026 EGF-like
IPR000742 1372 1407 PS50026 EGF-like
IPR000742 1420 1450 PS50026 EGF-like
IPR000742 1458 1493 PS50026 EGF-like
IPR000742 1544 1579 PS50026 EGF-like
ScanRegExp IPR013032 222 233 PS00022 EGF-like region
IPR013032 222 233 PS01186 EGF-like region
IPR001881 236 260 PS01187 EGF-like calcium-binding
IPR000152 251 262 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 260 275 PS01186 EGF-like region
IPR013032 302 317 PS01186 EGF-like region
IPR013032 343 358 PS01186 EGF-like region
IPR001881 360 384 PS01187 EGF-like calcium-binding
IPR000152 375 386 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 384 399 PS01186 EGF-like region
IPR013032 430 445 PS01186 EGF-like region
IPR001881 447 470 PS01187 EGF-like calcium-binding
IPR000152 461 472 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 470 485 PS01186 EGF-like region
IPR001881 487 511 PS01187 EGF-like calcium-binding
IPR000152 502 513 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 511 526 PS01186 EGF-like region
IPR013032 615 626 PS00022 EGF-like region
IPR013032 615 630 PS01186 EGF-like region
IPR013032 658 669 PS00022 EGF-like region
IPR013032 701 712 PS00022 EGF-like region
IPR013032 746 757 PS00022 EGF-like region
IPR013032 746 761 PS01186 EGF-like region
IPR013032 833 844 PS00022 EGF-like region
IPR013032 877 888 PS00022 EGF-like region
IPR013032 877 892 PS01186 EGF-like region
IPR013032 920 931 PS00022 EGF-like region
IPR013032 920 935 PS01186 EGF-like region
IPR013032 964 975 PS00022 EGF-like region
IPR013032 964 979 PS01186 EGF-like region
IPR013032 1007 1018 PS00022 EGF-like region
IPR013032 1007 1022 PS01186 EGF-like region
IPR013032 1050 1061 PS00022 EGF-like region
IPR013032 1093 1104 PS00022 EGF-like region
IPR013032 1093 1108 PS01186 EGF-like region
IPR013032 1136 1147 PS00022 EGF-like region
IPR013032 1136 1151 PS01186 EGF-like region
IPR013032 1179 1190 PS00022 EGF-like region
IPR013032 1179 1194 PS01186 EGF-like region
IPR013032 1222 1233 PS00022 EGF-like region
IPR013032 1222 1237 PS01186 EGF-like region
IPR013032 1266 1277 PS00022 EGF-like region
IPR013032 1266 1281 PS01186 EGF-like region
IPR013032 1309 1320 PS00022 EGF-like region
IPR013032 1309 1324 PS01186 EGF-like region
IPR013032 1352 1363 PS00022 EGF-like region
IPR013032 1395 1406 PS00022 EGF-like region
IPR013032 1395 1410 PS01186 EGF-like region
IPR013032 1438 1449 PS00022 EGF-like region
IPR013032 1438 1453 PS01186 EGF-like region
IPR013032 1481 1492 PS00022 EGF-like region
IPR013032 1481 1496 PS01186 EGF-like region
IPR013032 1524 1535 PS00022 EGF-like region
IPR013032 1567 1578 PS00022 EGF-like region
IPR013032 1567 1578 PS01186 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 84 AAGRAVVLALVLLLLPAVPVGAS 106 PRIMARY 23
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f GTCGCCCAGCCCGTATTTATG
Primer_r GATTGGGCAGGAGATGACAGG
PCR product length 102 bp
PCR conditions 95 °C15 sec66 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp