KIAA0149

Product ID	ORK00429
Accession No	D63483
Description	scavenger receptor class F, member 1, transcript variant 1
Clone name	ha01221
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3387 bp) Predicted protein sequence (830 aa)
HaloTag ORF Clone	FHC00429
Flexi ORF Clone	FXC00429
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0149 by Kazusa Mouse cDNA Project

Length: 3387 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	892 bp
Genome contig ID	gi51511734r_1383937
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- CTTTGTTAAAAAAATAAAAAGTACTAACATTACAG
Flanking genome sequence (99972 - 99923)	----+--------+--------+--------+--------+----* ACATGTATAAAGTAAAACGGAGATTTCCTTTCTCCCCAGAGGCGTCTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	1483909	1495743	11	99.4	Perfect prediction

Length: 830 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14162	0	99.9	Endothelial cel...	Homo sapiens
NP_003684	0	99.5	scavenger recep...	Homo sapiens
BAF84499	0	99.5	unnamed protein...	Homo sapiens
XP_853984	0	77.6	similar to scav...	Canis lupus fam...
EDM05225	6.3e-215	71.6	rCG35217 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058677	4.7e-25	36.0	KIAA1781
AB058676	1.9e-23	34.0	KIAA1780
AB011539	2.5e-18	37.4	KIAA0815
AB067494	5e-11	31.9	KIAA1907
AB040888	1.9e-08	31.5	KIAA1455

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	111	129	PR00011	EGF-like
	IPR002049	172	190	PR00011	EGF-like
	IPR002049	230	248	PR00011	EGF-like
HMMPfam	IPR013111	57	86	PF07974	EGF
	IPR002049	103	130	PF00053	EGF-like
	IPR002049	163	190	PF00053	EGF-like
HMMSmart	IPR006210	51	87	SM00181	EGF
	IPR006210	98	130	SM00181	EGF
	IPR006210	132	160	SM00181	EGF
	IPR006210	162	191	SM00181	EGF
	IPR006210	195	220	SM00181	EGF
	IPR006210	224	249	SM00181	EGF
	IPR006210	260	294	SM00181	EGF
	IPR006210	305	339	SM00181	EGF
	IPR006210	350	395	SM00181	EGF
ProfileScan	IPR000742	53	87	PS50026	EGF-like
	IPR000742	95	130	PS50026	EGF-like
	IPR000742	215	249	PS50026	EGF-like
ScanRegExp	IPR013032	75	86	PS00022	EGF-like region
	IPR013032	75	90	PS01186	EGF-like region
	IPR013032	118	129	PS00022	EGF-like region
	IPR013032	148	163	PS01186	EGF-like region
	IPR013032	179	190	PS00022	EGF-like region
	IPR013032	179	194	PS01186	EGF-like region
	IPR013032	208	219	PS00022	EGF-like region
	IPR013032	208	223	PS01186	EGF-like region
	IPR013032	237	248	PS00022	EGF-like region
	IPR013032	237	252	PS01186	EGF-like region
	IPR013032	370	381	PS00022	EGF-like region
	IPR013032	370	385	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	MGLGLLLPLLLLWTRGTQ	18	SECONDARY	18
SOSUI2	2	423	LIVGSLVPLLLLFLGLACCACCC	445	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CAGAAGGATCAAGAATGCACC
Primer_r	AGAATCCAGGCTTGCATCGAC
PCR product length	106 (0.3k) bp
PCR conditions	95 °C15 sec64 °C120 sec30 cycles