Gene/Protein Characteristic Table for KIAA0547
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00558
Accession No AB011119
Description leucine carboxyl methyltransferase 2
Clone name hh00544
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5658 bp)
Predicted protein sequence (696 aa)
Flexi ORF Clone FXC00558
Source Human adult brain
Rouge ID mKIAA0547 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5658 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 696 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG09759 0 100.0 leucine carboxy...
synthetic construct
O60294 0 99.9 Leucine carboxy...
Homo sapiens
BAF85276 0 99.7 unnamed protein...
Homo sapiens
XP_001157403 0 99.0 leucine carboxy...
Pan troglodytes
XP_001106399 0 95.6 similar to leuc...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007213 21 323 PF04072 Leucine carboxyl methyltransferase
IPR011498 490 538 PF07646 Kelch repeat type 2
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AGATTCTCTGTGGTAGGTTCT
Primer_r ACCCTCTGCTATTCTGTTGCC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name GeneBridge 4
Primer_f AGATTCTCTGTGGTAGGTTCT
Primer_r ACCCTCTGCTATTCTGTTGCC
PCR product length 115 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp