KIAA0554

Product ID	ORK00561
Accession No	AB011126
Description	formin binding protein 1
Clone name	hh00877
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5383 bp) Predicted protein sequence (674 aa)
HaloTag ORF Clone	FHC00561
Flexi ORF Clone	FXC00561
Source	Human adult brain
Rouge ID	mKIAA0554 by Kazusa Mouse cDNA Project

Length: 5383 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3356 bp
Genome contig ID	gi89161216r_131589287
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TGTTAATCTCGTGTTAAAATAAAATATAACTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GCTCCGTGTCACGGGACTGTTTTGTTGCATGAAGATATGACCCTAGTTGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	131689287	131845248	16	99.2	Perfect prediction

Length: 674 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAK49824	3.5e-215	100.0	formin-binding ...	Homo sapiens
EAW87916	3.1e-212	99.3	formin binding ...	Homo sapiens
Q96RU3	1.5e-194	100.0	Formin-binding ...	Homo sapiens
CAI12149	2.5e-193	99.5	formin binding ...	Homo sapiens
AAI43514	2.7e-192	99.2	FNBP1 protein [...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	613	664	PD000066	Src homology-3
FPrintScan	IPR001452	610	620	PR00452	Src homology-3
	IPR001452	624	639	PR00452	Src homology-3
	IPR001452	654	666	PR00452	Src homology-3
HMMPfam	IPR001060	58	151	PF00611	Cdc15/Fes/CIP4
HMMPfam	IPR001452	610	666	PF00018	Src homology-3
HMMSmart	IPR001060	58	151	SM00055	Cdc15/Fes/CIP4
HMMSmart	IPR001452	610	667	SM00326	Src homology-3
ProfileScan	IPR001060	58	122	PS50133	Cdc15/Fes/CIP4
ProfileScan	IPR001452	607	664	PS50002	Src homology-3

Primer_f	GGTTTAATTCCATCTCCAGAG
Primer_r	TTTTGCTGTGTGAGGCCGATC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGTTTAATTCCATCTCCAGAG
Primer_r	TTTTGCTGTGTGAGGCCGATC
PCR product length	147 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles